Incidental Mutation 'R1793:Fcho1'
ID 201946
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 039823-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R1793 (G1)
Quality Score 168
Status Validated
Chromosome 8
Chromosomal Location 72161031-72178360 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 72161666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 835 (Q835*)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000136640] [ENSMUST00000146100]
AlphaFold Q8K285
Predicted Effect probably null
Transcript: ENSMUST00000093444
AA Change: Q835*
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: Q835*

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably null
Transcript: ENSMUST00000146100
AA Change: Q835*
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: Q835*

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212029
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 100% (122/122)
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,884,144 (GRCm39) H571Q probably damaging Het
Abcf2 T A 5: 24,773,774 (GRCm39) M372L probably benign Het
Acaca A C 11: 84,206,795 (GRCm39) T1552P probably damaging Het
Acaca A G 11: 84,229,219 (GRCm39) D1682G probably damaging Het
Acvr1b T C 15: 101,091,906 (GRCm39) V62A probably benign Het
Aimp1 C T 3: 132,379,825 (GRCm39) V97M probably benign Het
Aldh1l1 C T 6: 90,554,813 (GRCm39) T557I possibly damaging Het
Alpk1 T C 3: 127,471,447 (GRCm39) T1012A probably damaging Het
Amot G A X: 144,233,585 (GRCm39) probably benign Het
Arap1 T A 7: 101,037,829 (GRCm39) H477Q probably benign Het
Arhgap18 T A 10: 26,736,732 (GRCm39) probably benign Het
Arhgef10l C T 4: 140,242,684 (GRCm39) V862M probably damaging Het
Arl4d A G 11: 101,557,554 (GRCm39) I27V probably benign Het
Asb18 G A 1: 89,942,277 (GRCm39) P8L probably damaging Het
Ash1l A G 3: 88,977,616 (GRCm39) H2682R probably damaging Het
Aspm T A 1: 139,385,079 (GRCm39) V241E probably benign Het
Atf7ip G T 6: 136,586,217 (GRCm39) probably benign Het
AY358078 T G 14: 52,042,051 (GRCm39) M142R unknown Het
C3 T A 17: 57,526,592 (GRCm39) K796N possibly damaging Het
Ceacam16 T C 7: 19,590,041 (GRCm39) T301A probably damaging Het
Ceacam5 T G 7: 17,481,320 (GRCm39) Y356D probably benign Het
Cep192 C T 18: 67,984,838 (GRCm39) A1616V possibly damaging Het
Cfap91 T A 16: 38,141,781 (GRCm39) N384Y possibly damaging Het
Cherp A T 8: 73,216,994 (GRCm39) H645Q probably benign Het
CK137956 T C 4: 127,845,242 (GRCm39) D167G probably benign Het
Clcn1 T A 6: 42,275,860 (GRCm39) probably null Het
Cntn1 C T 15: 92,189,552 (GRCm39) T625I possibly damaging Het
Cpn2 T A 16: 30,078,142 (GRCm39) N520Y probably damaging Het
Crocc G A 4: 140,746,620 (GRCm39) R1762W probably damaging Het
Cts3 C A 13: 61,715,967 (GRCm39) V100F probably benign Het
Ddx56 A T 11: 6,216,934 (GRCm39) V87D probably damaging Het
Dnah9 C T 11: 66,010,420 (GRCm39) probably null Het
Dock1 T A 7: 134,700,456 (GRCm39) probably null Het
Dst T A 1: 34,191,552 (GRCm39) Y291* probably null Het
Eif4g3 T C 4: 137,898,442 (GRCm39) I1071T probably damaging Het
Fblim1 T C 4: 141,322,549 (GRCm39) Q78R probably damaging Het
Fcamr C T 1: 130,739,284 (GRCm39) P195S probably benign Het
Frem3 A G 8: 81,339,741 (GRCm39) N678S probably benign Het
Frk G A 10: 34,483,878 (GRCm39) R413H probably benign Het
Gm10619 C A 7: 73,459,758 (GRCm39) noncoding transcript Het
Gm12185 G A 11: 48,806,583 (GRCm39) R203* probably null Het
Gm12886 A G 4: 121,280,174 (GRCm39) V34A probably benign Het
Gna12 A T 5: 140,746,707 (GRCm39) I246N probably damaging Het
Gpm6a T C 8: 55,507,867 (GRCm39) M201T probably benign Het
Gpsm2 T G 3: 108,608,225 (GRCm39) D220A probably benign Het
Grip2 C G 6: 91,760,623 (GRCm39) V325L probably benign Het
Grk5 C A 19: 61,065,200 (GRCm39) A288D probably damaging Het
Herpud2 G A 9: 25,021,953 (GRCm39) A231V possibly damaging Het
Hmcn1 T C 1: 150,624,834 (GRCm39) S1024G probably benign Het
Hp1bp3 A G 4: 137,957,820 (GRCm39) D295G probably damaging Het
Igsf21 T C 4: 139,761,703 (GRCm39) H325R probably damaging Het
Ing2 T A 8: 48,122,364 (GRCm39) L61F probably damaging Het
Jak3 T C 8: 72,138,590 (GRCm39) probably benign Het
Kcnn3 T A 3: 89,516,712 (GRCm39) C374S probably benign Het
Klk1b22 A G 7: 43,765,775 (GRCm39) probably benign Het
Larp1 T C 11: 57,940,764 (GRCm39) M630T possibly damaging Het
Lhx5 T A 5: 120,572,725 (GRCm39) C115S probably damaging Het
Lmcd1 C A 6: 112,305,712 (GRCm39) T271K probably benign Het
Lpar1 G A 4: 58,486,798 (GRCm39) R158* probably null Het
Lyst T A 13: 13,821,668 (GRCm39) C1347* probably null Het
Map3k8 G A 18: 4,332,389 (GRCm39) Q441* probably null Het
Mboat1 T C 13: 30,403,633 (GRCm39) V144A probably damaging Het
Mcur1 C T 13: 43,713,491 (GRCm39) G38S unknown Het
Med13 T A 11: 86,220,177 (GRCm39) M276L probably benign Het
Mefv A G 16: 3,526,528 (GRCm39) S699P possibly damaging Het
Mfsd4a C A 1: 131,987,077 (GRCm39) A62S probably damaging Het
Mmp27 A G 9: 7,571,459 (GRCm39) M1V probably null Het
Myo1c C T 11: 75,548,415 (GRCm39) T58I probably damaging Het
Myom3 A T 4: 135,538,066 (GRCm39) D1316V probably benign Het
Naa25 T A 5: 121,555,478 (GRCm39) C235S possibly damaging Het
Naa25 C A 5: 121,558,656 (GRCm39) R333S probably damaging Het
Nav3 G A 10: 109,539,233 (GRCm39) T2056I probably benign Het
Nol4 A G 18: 22,902,878 (GRCm39) Y378H probably damaging Het
Npat G A 9: 53,463,589 (GRCm39) R124Q probably damaging Het
Npr3 T A 15: 11,848,665 (GRCm39) E434V probably benign Het
Nptx2 A G 5: 144,485,130 (GRCm39) T208A probably benign Het
Obscn C T 11: 58,968,606 (GRCm39) V2798M probably damaging Het
Odad4 C A 11: 100,460,679 (GRCm39) probably null Het
Or10j7 A T 1: 173,011,976 (GRCm39) H8Q probably benign Het
Or52r1 A G 7: 102,537,250 (GRCm39) Y37H probably benign Het
Or5b122 C T 19: 13,562,779 (GRCm39) T37I probably benign Het
Padi1 G A 4: 140,541,967 (GRCm39) P652S probably damaging Het
Pcdh1 G T 18: 38,331,938 (GRCm39) P355Q probably damaging Het
Pck2 G A 14: 55,781,422 (GRCm39) R189H possibly damaging Het
Pcsk5 T A 19: 17,432,114 (GRCm39) K1500N possibly damaging Het
Phc3 A T 3: 31,002,865 (GRCm39) S218T probably damaging Het
Piezo2 T A 18: 63,239,355 (GRCm39) M510L possibly damaging Het
Polr1g T C 7: 19,091,904 (GRCm39) T68A possibly damaging Het
Ppp1r3a A T 6: 14,754,717 (GRCm39) Y177N probably damaging Het
Psme2b A T 11: 48,836,361 (GRCm39) D195E probably damaging Het
Ptprr T C 10: 116,088,827 (GRCm39) V463A probably damaging Het
Pwwp2b G A 7: 138,836,281 (GRCm39) R574Q probably damaging Het
Rap1gds1 T A 3: 138,756,314 (GRCm39) T14S possibly damaging Het
Rbm11 A T 16: 75,397,685 (GRCm39) K205M probably damaging Het
Rfx1 T A 8: 84,793,050 (GRCm39) probably benign Het
Rnasel C A 1: 153,630,169 (GRCm39) H228Q probably damaging Het
Sap130 T A 18: 31,831,640 (GRCm39) I710K probably benign Het
Slc27a4 C A 2: 29,695,733 (GRCm39) D89E probably benign Het
Spata31d1b T C 13: 59,863,779 (GRCm39) V309A probably benign Het
Syt7 T G 19: 10,421,354 (GRCm39) Y420D probably damaging Het
Tanc2 A G 11: 105,515,859 (GRCm39) probably null Het
Tbc1d10b A G 7: 126,802,930 (GRCm39) S333P possibly damaging Het
Tenm2 G A 11: 35,914,209 (GRCm39) P2442S probably damaging Het
Tenm3 C T 8: 49,127,579 (GRCm39) C33Y probably damaging Het
Timmdc1 A G 16: 38,319,419 (GRCm39) L245P possibly damaging Het
Tlr5 T C 1: 182,800,012 (GRCm39) F5L probably benign Het
Ttll4 T A 1: 74,726,999 (GRCm39) F784L possibly damaging Het
Tulp4 A G 17: 6,189,387 (GRCm39) T70A possibly damaging Het
Txndc17 T A 11: 72,099,571 (GRCm39) N81K probably benign Het
Ubr3 C T 2: 69,830,895 (GRCm39) probably benign Het
Uri1 A C 7: 37,681,116 (GRCm39) V96G probably damaging Het
Uspl1 T A 5: 149,150,246 (GRCm39) I482N probably damaging Het
Vmn1r229 A G 17: 21,034,974 (GRCm39) N73S possibly damaging Het
Vwa7 G T 17: 35,243,388 (GRCm39) G689* probably null Het
Zfp114 T A 7: 23,877,164 (GRCm39) probably null Het
Zfp618 A G 4: 63,051,474 (GRCm39) S659G probably damaging Het
Zfp872 A G 9: 22,111,349 (GRCm39) K275R probably damaging Het
Zzef1 C T 11: 72,777,535 (GRCm39) P1789S probably damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 72,166,167 (GRCm39) nonsense probably null
IGL01291:Fcho1 APN 8 72,165,191 (GRCm39) missense probably benign 0.08
IGL01473:Fcho1 APN 8 72,164,782 (GRCm39) missense probably benign 0.03
IGL02021:Fcho1 APN 8 72,173,919 (GRCm39) missense probably benign 0.06
IGL02086:Fcho1 APN 8 72,169,444 (GRCm39) missense probably damaging 1.00
IGL02808:Fcho1 APN 8 72,165,185 (GRCm39) missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 72,170,074 (GRCm39) splice site probably benign
IGL03267:Fcho1 APN 8 72,164,943 (GRCm39) unclassified probably benign
cameo UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
Lesser UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
Sidekick UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 72,165,191 (GRCm39) missense probably benign 0.08
R0003:Fcho1 UTSW 8 72,161,597 (GRCm39) missense probably damaging 1.00
R0010:Fcho1 UTSW 8 72,162,643 (GRCm39) missense probably damaging 1.00
R0020:Fcho1 UTSW 8 72,169,514 (GRCm39) missense probably benign 0.11
R0363:Fcho1 UTSW 8 72,170,134 (GRCm39) missense probably damaging 1.00
R0457:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0485:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0501:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0502:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0551:Fcho1 UTSW 8 72,164,818 (GRCm39) missense probably benign 0.06
R0583:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0584:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0585:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0612:Fcho1 UTSW 8 72,168,168 (GRCm39) missense probably damaging 1.00
R0614:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0647:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0841:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0842:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1034:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1036:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1399:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1618:Fcho1 UTSW 8 72,163,047 (GRCm39) missense probably damaging 0.98
R1754:Fcho1 UTSW 8 72,163,890 (GRCm39) missense probably benign
R2073:Fcho1 UTSW 8 72,163,133 (GRCm39) missense probably damaging 0.98
R2177:Fcho1 UTSW 8 72,164,905 (GRCm39) missense probably damaging 1.00
R4072:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4074:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4076:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4606:Fcho1 UTSW 8 72,165,124 (GRCm39) missense probably benign
R4732:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4733:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R5082:Fcho1 UTSW 8 72,169,829 (GRCm39) missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 72,169,820 (GRCm39) missense probably benign 0.00
R5185:Fcho1 UTSW 8 72,167,600 (GRCm39) unclassified probably benign
R6025:Fcho1 UTSW 8 72,165,217 (GRCm39) splice site probably null
R6624:Fcho1 UTSW 8 72,162,015 (GRCm39) missense probably damaging 0.99
R6875:Fcho1 UTSW 8 72,167,069 (GRCm39) splice site probably null
R7069:Fcho1 UTSW 8 72,163,141 (GRCm39) splice site probably null
R7476:Fcho1 UTSW 8 72,166,190 (GRCm39) missense probably damaging 1.00
R7512:Fcho1 UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 72,164,920 (GRCm39) missense probably benign 0.00
R8699:Fcho1 UTSW 8 72,162,277 (GRCm39) missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 72,169,790 (GRCm39) missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 72,169,468 (GRCm39) missense probably benign 0.03
R9447:Fcho1 UTSW 8 72,169,913 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAACCTCAGCAGCTGAC -3'
(R):5'- ATCCTGAGCCTGTGACAAAGAG -3'

Sequencing Primer
(F):5'- TCAGCAGCTGACGAGGTACATC -3'
(R):5'- CCTGTGACAAAGAGCCTGTGAC -3'
Posted On 2014-06-23