Incidental Mutation 'R1793:Rfx1'
ID201949
Institutional Source Beutler Lab
Gene Symbol Rfx1
Ensembl Gene ENSMUSG00000031706
Gene Nameregulatory factor X, 1 (influences HLA class II expression)
Synonyms
MMRRC Submission 039823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1793 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84066834-84096992 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 84066421 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005600] [ENSMUST00000098592] [ENSMUST00000211046]
Predicted Effect probably benign
Transcript: ENSMUST00000005600
SMART Domains Protein: ENSMUSP00000005600
Gene: ENSMUSG00000031706

DomainStartEndE-ValueType
low complexity region 11 47 N/A INTRINSIC
low complexity region 53 67 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
Pfam:RFX1_trans_act 106 176 9.6e-9 PFAM
Pfam:RFX1_trans_act 211 366 1.8e-59 PFAM
Pfam:RFX_DNA_binding 420 498 2.5e-35 PFAM
Blast:HisKA 705 768 3e-28 BLAST
low complexity region 908 920 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000071067
SMART Domains Protein: ENSMUSP00000065182
Gene: ENSMUSG00000056753

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098592
SMART Domains Protein: ENSMUSP00000096191
Gene: ENSMUSG00000074215

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210660
Predicted Effect probably benign
Transcript: ENSMUST00000211046
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulatory factor X (RFX) family of transcription factors, which are characterized by a winged-helix DNA-binding domain. The encoded transcription factor contains an N-terminal activation domain and a C-terminal repression domain, and may activate or repress target gene expression depending on cellular context. This transcription factor has been shown to regulate a wide variety of genes involved in immunity and cancer, including the MHC class II genes and genes that may be involved in cancer progression. This gene exhibits altered expression in glioblastoma and the autoimmune disease systemic lupus erythematosis (SLE). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,278 H571Q probably damaging Het
Abcf2 T A 5: 24,568,776 M372L probably benign Het
Acaca A C 11: 84,315,969 T1552P probably damaging Het
Acaca A G 11: 84,338,393 D1682G probably damaging Het
Acvr1b T C 15: 101,194,025 V62A probably benign Het
Aimp1 C T 3: 132,674,064 V97M probably benign Het
Aldh1l1 C T 6: 90,577,831 T557I possibly damaging Het
Alpk1 T C 3: 127,677,798 T1012A probably damaging Het
Amot G A X: 145,450,589 probably benign Het
Arap1 T A 7: 101,388,622 H477Q probably benign Het
Arhgap18 T A 10: 26,860,736 probably benign Het
Arhgef10l C T 4: 140,515,373 V862M probably damaging Het
Arl4d A G 11: 101,666,728 I27V probably benign Het
Asb18 G A 1: 90,014,555 P8L probably damaging Het
Ash1l A G 3: 89,070,309 H2682R probably damaging Het
Aspm T A 1: 139,457,341 V241E probably benign Het
Atf7ip G T 6: 136,609,219 probably benign Het
AY358078 T G 14: 51,804,594 M142R unknown Het
C3 T A 17: 57,219,592 K796N possibly damaging Het
Cd3eap T C 7: 19,357,979 T68A possibly damaging Het
Ceacam16 T C 7: 19,856,116 T301A probably damaging Het
Ceacam5 T G 7: 17,747,395 Y356D probably benign Het
Cep192 C T 18: 67,851,767 A1616V possibly damaging Het
Cherp A T 8: 72,463,150 H645Q probably benign Het
CK137956 T C 4: 127,951,449 D167G probably benign Het
Clcn1 T A 6: 42,298,926 probably null Het
Cntn1 C T 15: 92,291,671 T625I possibly damaging Het
Cpn2 T A 16: 30,259,324 N520Y probably damaging Het
Crocc G A 4: 141,019,309 R1762W probably damaging Het
Cts3 C A 13: 61,568,153 V100F probably benign Het
Ddx56 A T 11: 6,266,934 V87D probably damaging Het
Dnah9 C T 11: 66,119,594 probably null Het
Dock1 T A 7: 135,098,727 probably null Het
Dst T A 1: 34,152,471 Y291* probably null Het
Eif4g3 T C 4: 138,171,131 I1071T probably damaging Het
Fblim1 T C 4: 141,595,238 Q78R probably damaging Het
Fcamr C T 1: 130,811,547 P195S probably benign Het
Fcho1 G A 8: 71,709,022 Q835* probably null Het
Frem3 A G 8: 80,613,112 N678S probably benign Het
Frk G A 10: 34,607,882 R413H probably benign Het
Gm10619 C A 7: 73,810,010 noncoding transcript Het
Gm12185 G A 11: 48,915,756 R203* probably null Het
Gm12886 A G 4: 121,422,977 V34A probably benign Het
Gna12 A T 5: 140,760,952 I246N probably damaging Het
Gpm6a T C 8: 55,054,832 M201T probably benign Het
Gpsm2 T G 3: 108,700,909 D220A probably benign Het
Grip2 C G 6: 91,783,642 V325L probably benign Het
Grk5 C A 19: 61,076,762 A288D probably damaging Het
Herpud2 G A 9: 25,110,657 A231V possibly damaging Het
Hmcn1 T C 1: 150,749,083 S1024G probably benign Het
Hp1bp3 A G 4: 138,230,509 D295G probably damaging Het
Igsf21 T C 4: 140,034,392 H325R probably damaging Het
Ing2 T A 8: 47,669,329 L61F probably damaging Het
Jak3 T C 8: 71,685,946 probably benign Het
Kcnn3 T A 3: 89,609,405 C374S probably benign Het
Klk1b22 A G 7: 44,116,351 probably benign Het
Larp1 T C 11: 58,049,938 M630T possibly damaging Het
Lhx5 T A 5: 120,434,660 C115S probably damaging Het
Lmcd1 C A 6: 112,328,751 T271K probably benign Het
Lpar1 G A 4: 58,486,798 R158* probably null Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Maats1 T A 16: 38,321,419 N384Y possibly damaging Het
Map3k8 G A 18: 4,332,389 Q441* probably null Het
Mboat1 T C 13: 30,219,650 V144A probably damaging Het
Mcur1 C T 13: 43,560,015 G38S unknown Het
Med13 T A 11: 86,329,351 M276L probably benign Het
Mefv A G 16: 3,708,664 S699P possibly damaging Het
Mfsd4a C A 1: 132,059,339 A62S probably damaging Het
Mmp27 A G 9: 7,571,458 M1V probably null Het
Myo1c C T 11: 75,657,589 T58I probably damaging Het
Myom3 A T 4: 135,810,755 D1316V probably benign Het
Naa25 T A 5: 121,417,415 C235S possibly damaging Het
Naa25 C A 5: 121,420,593 R333S probably damaging Het
Nav3 G A 10: 109,703,372 T2056I probably benign Het
Nol4 A G 18: 22,769,821 Y378H probably damaging Het
Npat G A 9: 53,552,289 R124Q probably damaging Het
Npr3 T A 15: 11,848,579 E434V probably benign Het
Nptx2 A G 5: 144,548,320 T208A probably benign Het
Obscn C T 11: 59,077,780 V2798M probably damaging Het
Olfr1406 A T 1: 173,184,409 H8Q probably benign Het
Olfr1484 C T 19: 13,585,415 T37I probably benign Het
Olfr569 A G 7: 102,888,043 Y37H probably benign Het
Padi1 G A 4: 140,814,656 P652S probably damaging Het
Pcdh1 G T 18: 38,198,885 P355Q probably damaging Het
Pck2 G A 14: 55,543,965 R189H possibly damaging Het
Pcsk5 T A 19: 17,454,750 K1500N possibly damaging Het
Phc3 A T 3: 30,948,716 S218T probably damaging Het
Piezo2 T A 18: 63,106,284 M510L possibly damaging Het
Ppp1r3a A T 6: 14,754,718 Y177N probably damaging Het
Psme2b A T 11: 48,945,534 D195E probably damaging Het
Ptprr T C 10: 116,252,922 V463A probably damaging Het
Pwwp2b G A 7: 139,256,365 R574Q probably damaging Het
Rap1gds1 T A 3: 139,050,553 T14S possibly damaging Het
Rbm11 A T 16: 75,600,797 K205M probably damaging Het
Rnasel C A 1: 153,754,423 H228Q probably damaging Het
Sap130 T A 18: 31,698,587 I710K probably benign Het
Slc27a4 C A 2: 29,805,721 D89E probably benign Het
Spata31d1b T C 13: 59,715,965 V309A probably benign Het
Syt7 T G 19: 10,443,990 Y420D probably damaging Het
Tanc2 A G 11: 105,625,033 probably null Het
Tbc1d10b A G 7: 127,203,758 S333P possibly damaging Het
Tenm2 G A 11: 36,023,382 P2442S probably damaging Het
Tenm3 C T 8: 48,674,544 C33Y probably damaging Het
Timmdc1 A G 16: 38,499,057 L245P possibly damaging Het
Tlr5 T C 1: 182,972,447 F5L probably benign Het
Ttc25 C A 11: 100,569,853 probably null Het
Ttll4 T A 1: 74,687,840 F784L possibly damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Txndc17 T A 11: 72,208,745 N81K probably benign Het
Ubr3 C T 2: 70,000,551 probably benign Het
Uri1 A C 7: 37,981,691 V96G probably damaging Het
Uspl1 T A 5: 149,213,436 I482N probably damaging Het
Vmn1r229 A G 17: 20,814,712 N73S possibly damaging Het
Vwa7 G T 17: 35,024,412 G689* probably null Het
Zfp114 T A 7: 24,177,739 probably null Het
Zfp618 A G 4: 63,133,237 S659G probably damaging Het
Zfp872 A G 9: 22,200,053 K275R probably damaging Het
Zzef1 C T 11: 72,886,709 P1789S probably damaging Het
Other mutations in Rfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Rfx1 APN 8 84092972 critical splice acceptor site probably null
IGL01779:Rfx1 APN 8 84092662 splice site probably benign
IGL02505:Rfx1 APN 8 84095809 missense possibly damaging 0.79
IGL02741:Rfx1 APN 8 84095842 missense possibly damaging 0.94
R1565:Rfx1 UTSW 8 84073946 missense probably benign
R1808:Rfx1 UTSW 8 84095048 missense probably damaging 1.00
R1971:Rfx1 UTSW 8 84095497 missense probably damaging 1.00
R4542:Rfx1 UTSW 8 84090237 missense probably damaging 1.00
R4690:Rfx1 UTSW 8 84082745 missense possibly damaging 0.50
R4995:Rfx1 UTSW 8 84080114 splice site probably null
R5163:Rfx1 UTSW 8 84093211 missense probably damaging 0.98
R5212:Rfx1 UTSW 8 84066592 unclassified probably benign
R5227:Rfx1 UTSW 8 84074058 missense probably damaging 0.99
R5401:Rfx1 UTSW 8 84066376 unclassified probably null
R5431:Rfx1 UTSW 8 84082720 nonsense probably null
R5584:Rfx1 UTSW 8 84088077 splice site probably null
R5693:Rfx1 UTSW 8 84073904 missense unknown
R6210:Rfx1 UTSW 8 84093018 missense probably damaging 1.00
R6715:Rfx1 UTSW 8 84095815 missense possibly damaging 0.49
R6920:Rfx1 UTSW 8 84095488 missense probably damaging 1.00
R7131:Rfx1 UTSW 8 84095079 missense probably damaging 0.96
R7155:Rfx1 UTSW 8 84094826 missense probably damaging 0.99
R7336:Rfx1 UTSW 8 84073756 start gained probably benign
R7467:Rfx1 UTSW 8 84073913 missense possibly damaging 0.86
Z1177:Rfx1 UTSW 8 84090277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCATTAAATGTCTGCTGGC -3'
(R):5'- AAAGTCGGCTCTCTGGTTGG -3'

Sequencing Primer
(F):5'- AGAGACCTTTTCACTGCCTGAG -3'
(R):5'- TCTGGTTGGACTAACGAGAGATC -3'
Posted On2014-06-23