Mutagenetix > Incidental Mutation

Incidental Mutation 'R1793:Tenm2'

201960

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

039823-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.583) question?

Stock #

R1793 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 36023382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 2442 (P2442S)

Ref Sequence

ENSEMBL: ENSMUSP00000129951 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057207
AA Change: P2443S

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: P2443S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102801
AA Change: P2442S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: P2442S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163524
AA Change: P2442S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: P2442S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Meta Mutation Damage Score

0.3782

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

100% (122/122)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,736,278	H571Q	probably damaging	Het
Abcf2	T	A	5: 24,568,776	M372L	probably benign	Het
Acaca	A	C	11: 84,315,969	T1552P	probably damaging	Het
Acaca	A	G	11: 84,338,393	D1682G	probably damaging	Het
Acvr1b	T	C	15: 101,194,025	V62A	probably benign	Het
Aimp1	C	T	3: 132,674,064	V97M	probably benign	Het
Aldh1l1	C	T	6: 90,577,831	T557I	possibly damaging	Het
Alpk1	T	C	3: 127,677,798	T1012A	probably damaging	Het
Amot	G	A	X: 145,450,589		probably benign	Het
Arap1	T	A	7: 101,388,622	H477Q	probably benign	Het
Arhgap18	T	A	10: 26,860,736		probably benign	Het
Arhgef10l	C	T	4: 140,515,373	V862M	probably damaging	Het
Arl4d	A	G	11: 101,666,728	I27V	probably benign	Het
Asb18	G	A	1: 90,014,555	P8L	probably damaging	Het
Ash1l	A	G	3: 89,070,309	H2682R	probably damaging	Het
Aspm	T	A	1: 139,457,341	V241E	probably benign	Het
Atf7ip	G	T	6: 136,609,219		probably benign	Het
AY358078	T	G	14: 51,804,594	M142R	unknown	Het
C3	T	A	17: 57,219,592	K796N	possibly damaging	Het
Cd3eap	T	C	7: 19,357,979	T68A	possibly damaging	Het
Ceacam16	T	C	7: 19,856,116	T301A	probably damaging	Het
Ceacam5	T	G	7: 17,747,395	Y356D	probably benign	Het
Cep192	C	T	18: 67,851,767	A1616V	possibly damaging	Het
Cherp	A	T	8: 72,463,150	H645Q	probably benign	Het
CK137956	T	C	4: 127,951,449	D167G	probably benign	Het
Clcn1	T	A	6: 42,298,926		probably null	Het
Cntn1	C	T	15: 92,291,671	T625I	possibly damaging	Het
Cpn2	T	A	16: 30,259,324	N520Y	probably damaging	Het
Crocc	G	A	4: 141,019,309	R1762W	probably damaging	Het
Cts3	C	A	13: 61,568,153	V100F	probably benign	Het
Ddx56	A	T	11: 6,266,934	V87D	probably damaging	Het
Dnah9	C	T	11: 66,119,594		probably null	Het
Dock1	T	A	7: 135,098,727		probably null	Het
Dst	T	A	1: 34,152,471	Y291*	probably null	Het
Eif4g3	T	C	4: 138,171,131	I1071T	probably damaging	Het
Fblim1	T	C	4: 141,595,238	Q78R	probably damaging	Het
Fcamr	C	T	1: 130,811,547	P195S	probably benign	Het
Fcho1	G	A	8: 71,709,022	Q835*	probably null	Het
Frem3	A	G	8: 80,613,112	N678S	probably benign	Het
Frk	G	A	10: 34,607,882	R413H	probably benign	Het
Gm10619	C	A	7: 73,810,010		noncoding transcript	Het
Gm12185	G	A	11: 48,915,756	R203*	probably null	Het
Gm12886	A	G	4: 121,422,977	V34A	probably benign	Het
Gna12	A	T	5: 140,760,952	I246N	probably damaging	Het
Gpm6a	T	C	8: 55,054,832	M201T	probably benign	Het
Gpsm2	T	G	3: 108,700,909	D220A	probably benign	Het
Grip2	C	G	6: 91,783,642	V325L	probably benign	Het
Grk5	C	A	19: 61,076,762	A288D	probably damaging	Het
Herpud2	G	A	9: 25,110,657	A231V	possibly damaging	Het
Hmcn1	T	C	1: 150,749,083	S1024G	probably benign	Het
Hp1bp3	A	G	4: 138,230,509	D295G	probably damaging	Het
Igsf21	T	C	4: 140,034,392	H325R	probably damaging	Het
Ing2	T	A	8: 47,669,329	L61F	probably damaging	Het
Jak3	T	C	8: 71,685,946		probably benign	Het
Kcnn3	T	A	3: 89,609,405	C374S	probably benign	Het
Klk1b22	A	G	7: 44,116,351		probably benign	Het
Larp1	T	C	11: 58,049,938	M630T	possibly damaging	Het
Lhx5	T	A	5: 120,434,660	C115S	probably damaging	Het
Lmcd1	C	A	6: 112,328,751	T271K	probably benign	Het
Lpar1	G	A	4: 58,486,798	R158*	probably null	Het
Lyst	T	A	13: 13,647,083	C1347*	probably null	Het
Maats1	T	A	16: 38,321,419	N384Y	possibly damaging	Het
Map3k8	G	A	18: 4,332,389	Q441*	probably null	Het
Mboat1	T	C	13: 30,219,650	V144A	probably damaging	Het
Mcur1	C	T	13: 43,560,015	G38S	unknown	Het
Med13	T	A	11: 86,329,351	M276L	probably benign	Het
Mefv	A	G	16: 3,708,664	S699P	possibly damaging	Het
Mfsd4a	C	A	1: 132,059,339	A62S	probably damaging	Het
Mmp27	A	G	9: 7,571,458	M1V	probably null	Het
Myo1c	C	T	11: 75,657,589	T58I	probably damaging	Het
Myom3	A	T	4: 135,810,755	D1316V	probably benign	Het
Naa25	C	A	5: 121,420,593	R333S	probably damaging	Het
Naa25	T	A	5: 121,417,415	C235S	possibly damaging	Het
Nav3	G	A	10: 109,703,372	T2056I	probably benign	Het
Nol4	A	G	18: 22,769,821	Y378H	probably damaging	Het
Npat	G	A	9: 53,552,289	R124Q	probably damaging	Het
Npr3	T	A	15: 11,848,579	E434V	probably benign	Het
Nptx2	A	G	5: 144,548,320	T208A	probably benign	Het
Obscn	C	T	11: 59,077,780	V2798M	probably damaging	Het
Olfr1406	A	T	1: 173,184,409	H8Q	probably benign	Het
Olfr1484	C	T	19: 13,585,415	T37I	probably benign	Het
Olfr569	A	G	7: 102,888,043	Y37H	probably benign	Het
Padi1	G	A	4: 140,814,656	P652S	probably damaging	Het
Pcdh1	G	T	18: 38,198,885	P355Q	probably damaging	Het
Pck2	G	A	14: 55,543,965	R189H	possibly damaging	Het
Pcsk5	T	A	19: 17,454,750	K1500N	possibly damaging	Het
Phc3	A	T	3: 30,948,716	S218T	probably damaging	Het
Piezo2	T	A	18: 63,106,284	M510L	possibly damaging	Het
Ppp1r3a	A	T	6: 14,754,718	Y177N	probably damaging	Het
Psme2b	A	T	11: 48,945,534	D195E	probably damaging	Het
Ptprr	T	C	10: 116,252,922	V463A	probably damaging	Het
Pwwp2b	G	A	7: 139,256,365	R574Q	probably damaging	Het
Rap1gds1	T	A	3: 139,050,553	T14S	possibly damaging	Het
Rbm11	A	T	16: 75,600,797	K205M	probably damaging	Het
Rfx1	T	A	8: 84,066,421		probably benign	Het
Rnasel	C	A	1: 153,754,423	H228Q	probably damaging	Het
Sap130	T	A	18: 31,698,587	I710K	probably benign	Het
Slc27a4	C	A	2: 29,805,721	D89E	probably benign	Het
Spata31d1b	T	C	13: 59,715,965	V309A	probably benign	Het
Syt7	T	G	19: 10,443,990	Y420D	probably damaging	Het
Tanc2	A	G	11: 105,625,033		probably null	Het
Tbc1d10b	A	G	7: 127,203,758	S333P	possibly damaging	Het
Tenm3	C	T	8: 48,674,544	C33Y	probably damaging	Het
Timmdc1	A	G	16: 38,499,057	L245P	possibly damaging	Het
Tlr5	T	C	1: 182,972,447	F5L	probably benign	Het
Ttc25	C	A	11: 100,569,853		probably null	Het
Ttll4	T	A	1: 74,687,840	F784L	possibly damaging	Het
Tulp4	A	G	17: 6,139,112	T70A	possibly damaging	Het
Txndc17	T	A	11: 72,208,745	N81K	probably benign	Het
Ubr3	C	T	2: 70,000,551		probably benign	Het
Uri1	A	C	7: 37,981,691	V96G	probably damaging	Het
Uspl1	T	A	5: 149,213,436	I482N	probably damaging	Het
Vmn1r229	A	G	17: 20,814,712	N73S	possibly damaging	Het
Vwa7	G	T	17: 35,024,412	G689*	probably null	Het
Zfp114	T	A	7: 24,177,739		probably null	Het
Zfp618	A	G	4: 63,133,237	S659G	probably damaging	Het
Zfp872	A	G	9: 22,200,053	K275R	probably damaging	Het
Zzef1	C	T	11: 72,886,709	P1789S	probably damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCCAGCCCTAGAGTTCTACTG -3'
(R):5'- GCCTCATGATCAAGCAACTGC -3'

Sequencing Primer
(F):5'- GCCCTAGAGTTCTACTGTAAAGCG -3'
(R):5'- CACAGCCTATGGGGAGATCTACTATG -3'

Posted On

2014-06-23