Incidental Mutation 'R0091:Morn1'
ID20197
Institutional Source Beutler Lab
Gene Symbol Morn1
Ensembl Gene ENSMUSG00000029049
Gene NameMORN repeat containing 1
Synonyms2900057D20Rik, 4930417P05Rik
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0091 (G1)
Quality Score134
Status Validated (trace)
Chromosome4
Chromosomal Location155086577-155145505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155145172 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 433 (Y433H)
Ref Sequence ENSEMBL: ENSMUSP00000030915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030915]
Predicted Effect probably damaging
Transcript: ENSMUST00000030915
AA Change: Y433H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030915
Gene: ENSMUSG00000029049
AA Change: Y433H

DomainStartEndE-ValueType
Pfam:MORN 23 35 1.4e-3 PFAM
MORN 37 58 4.11e-6 SMART
MORN 60 81 2.41e-1 SMART
MORN 84 105 1.43e-1 SMART
MORN 107 128 8.05e0 SMART
MORN 130 151 2.06e-6 SMART
MORN 153 174 7.56e-5 SMART
MORN 176 197 1.2e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155375
Meta Mutation Damage Score 0.2172 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Morn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Morn1 APN 4 155092328 missense possibly damaging 0.81
IGL01143:Morn1 APN 4 155092304 missense probably damaging 1.00
IGL02214:Morn1 APN 4 155092319 missense probably damaging 1.00
IGL03112:Morn1 APN 4 155093144 missense probably damaging 1.00
R0573:Morn1 UTSW 4 155111016 missense possibly damaging 0.87
R0639:Morn1 UTSW 4 155089503 missense possibly damaging 0.92
R0918:Morn1 UTSW 4 155087471 missense probably damaging 1.00
R2041:Morn1 UTSW 4 155090942 missense probably damaging 1.00
R2360:Morn1 UTSW 4 155092313 missense probably damaging 0.98
R5831:Morn1 UTSW 4 155101276 missense probably benign 0.02
R6897:Morn1 UTSW 4 155086655 missense probably benign 0.06
R8178:Morn1 UTSW 4 155128703 missense probably benign 0.00
R8505:Morn1 UTSW 4 155093335 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTTGCCCAAACGCTTGCTAAC -3'
(R):5'- GAGTCCCACAAAAGGTGCTACTCAG -3'

Sequencing Primer
(F):5'- ACGCTTGCTAACCAAACAC -3'
(R):5'- TCAATCTCCATTCAGGGAAGG -3'
Posted On2013-04-11