Incidental Mutation 'R1793:Mefv'
ID201986
Institutional Source Beutler Lab
Gene Symbol Mefv
Ensembl Gene ENSMUSG00000022534
Gene NameMediterranean fever
SynonymsTRIM20, marenostrin, pyrin, FMF
MMRRC Submission 039823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1793 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3707218-3718097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3708664 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 699 (S699P)
Ref Sequence ENSEMBL: ENSMUSP00000154892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]
Predicted Effect probably benign
Transcript: ENSMUST00000023180
AA Change: S699P

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534
AA Change: S699P

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 439 481 4.75e-11 SMART
low complexity region 490 503 N/A INTRINSIC
SCOP:d1f5qb1 519 616 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100222
AA Change: S729P

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534
AA Change: S729P

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 469 511 4.75e-11 SMART
low complexity region 520 533 N/A INTRINSIC
SCOP:d1f5qb1 549 646 6e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229725
AA Change: S699P

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,278 H571Q probably damaging Het
Abcf2 T A 5: 24,568,776 M372L probably benign Het
Acaca A C 11: 84,315,969 T1552P probably damaging Het
Acaca A G 11: 84,338,393 D1682G probably damaging Het
Acvr1b T C 15: 101,194,025 V62A probably benign Het
Aimp1 C T 3: 132,674,064 V97M probably benign Het
Aldh1l1 C T 6: 90,577,831 T557I possibly damaging Het
Alpk1 T C 3: 127,677,798 T1012A probably damaging Het
Amot G A X: 145,450,589 probably benign Het
Arap1 T A 7: 101,388,622 H477Q probably benign Het
Arhgap18 T A 10: 26,860,736 probably benign Het
Arhgef10l C T 4: 140,515,373 V862M probably damaging Het
Arl4d A G 11: 101,666,728 I27V probably benign Het
Asb18 G A 1: 90,014,555 P8L probably damaging Het
Ash1l A G 3: 89,070,309 H2682R probably damaging Het
Aspm T A 1: 139,457,341 V241E probably benign Het
Atf7ip G T 6: 136,609,219 probably benign Het
AY358078 T G 14: 51,804,594 M142R unknown Het
C3 T A 17: 57,219,592 K796N possibly damaging Het
Cd3eap T C 7: 19,357,979 T68A possibly damaging Het
Ceacam16 T C 7: 19,856,116 T301A probably damaging Het
Ceacam5 T G 7: 17,747,395 Y356D probably benign Het
Cep192 C T 18: 67,851,767 A1616V possibly damaging Het
Cherp A T 8: 72,463,150 H645Q probably benign Het
CK137956 T C 4: 127,951,449 D167G probably benign Het
Clcn1 T A 6: 42,298,926 probably null Het
Cntn1 C T 15: 92,291,671 T625I possibly damaging Het
Cpn2 T A 16: 30,259,324 N520Y probably damaging Het
Crocc G A 4: 141,019,309 R1762W probably damaging Het
Cts3 C A 13: 61,568,153 V100F probably benign Het
Ddx56 A T 11: 6,266,934 V87D probably damaging Het
Dnah9 C T 11: 66,119,594 probably null Het
Dock1 T A 7: 135,098,727 probably null Het
Dst T A 1: 34,152,471 Y291* probably null Het
Eif4g3 T C 4: 138,171,131 I1071T probably damaging Het
Fblim1 T C 4: 141,595,238 Q78R probably damaging Het
Fcamr C T 1: 130,811,547 P195S probably benign Het
Fcho1 G A 8: 71,709,022 Q835* probably null Het
Frem3 A G 8: 80,613,112 N678S probably benign Het
Frk G A 10: 34,607,882 R413H probably benign Het
Gm10619 C A 7: 73,810,010 noncoding transcript Het
Gm12185 G A 11: 48,915,756 R203* probably null Het
Gm12886 A G 4: 121,422,977 V34A probably benign Het
Gna12 A T 5: 140,760,952 I246N probably damaging Het
Gpm6a T C 8: 55,054,832 M201T probably benign Het
Gpsm2 T G 3: 108,700,909 D220A probably benign Het
Grip2 C G 6: 91,783,642 V325L probably benign Het
Grk5 C A 19: 61,076,762 A288D probably damaging Het
Herpud2 G A 9: 25,110,657 A231V possibly damaging Het
Hmcn1 T C 1: 150,749,083 S1024G probably benign Het
Hp1bp3 A G 4: 138,230,509 D295G probably damaging Het
Igsf21 T C 4: 140,034,392 H325R probably damaging Het
Ing2 T A 8: 47,669,329 L61F probably damaging Het
Jak3 T C 8: 71,685,946 probably benign Het
Kcnn3 T A 3: 89,609,405 C374S probably benign Het
Klk1b22 A G 7: 44,116,351 probably benign Het
Larp1 T C 11: 58,049,938 M630T possibly damaging Het
Lhx5 T A 5: 120,434,660 C115S probably damaging Het
Lmcd1 C A 6: 112,328,751 T271K probably benign Het
Lpar1 G A 4: 58,486,798 R158* probably null Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Maats1 T A 16: 38,321,419 N384Y possibly damaging Het
Map3k8 G A 18: 4,332,389 Q441* probably null Het
Mboat1 T C 13: 30,219,650 V144A probably damaging Het
Mcur1 C T 13: 43,560,015 G38S unknown Het
Med13 T A 11: 86,329,351 M276L probably benign Het
Mfsd4a C A 1: 132,059,339 A62S probably damaging Het
Mmp27 A G 9: 7,571,458 M1V probably null Het
Myo1c C T 11: 75,657,589 T58I probably damaging Het
Myom3 A T 4: 135,810,755 D1316V probably benign Het
Naa25 T A 5: 121,417,415 C235S possibly damaging Het
Naa25 C A 5: 121,420,593 R333S probably damaging Het
Nav3 G A 10: 109,703,372 T2056I probably benign Het
Nol4 A G 18: 22,769,821 Y378H probably damaging Het
Npat G A 9: 53,552,289 R124Q probably damaging Het
Npr3 T A 15: 11,848,579 E434V probably benign Het
Nptx2 A G 5: 144,548,320 T208A probably benign Het
Obscn C T 11: 59,077,780 V2798M probably damaging Het
Olfr1406 A T 1: 173,184,409 H8Q probably benign Het
Olfr1484 C T 19: 13,585,415 T37I probably benign Het
Olfr569 A G 7: 102,888,043 Y37H probably benign Het
Padi1 G A 4: 140,814,656 P652S probably damaging Het
Pcdh1 G T 18: 38,198,885 P355Q probably damaging Het
Pck2 G A 14: 55,543,965 R189H possibly damaging Het
Pcsk5 T A 19: 17,454,750 K1500N possibly damaging Het
Phc3 A T 3: 30,948,716 S218T probably damaging Het
Piezo2 T A 18: 63,106,284 M510L possibly damaging Het
Ppp1r3a A T 6: 14,754,718 Y177N probably damaging Het
Psme2b A T 11: 48,945,534 D195E probably damaging Het
Ptprr T C 10: 116,252,922 V463A probably damaging Het
Pwwp2b G A 7: 139,256,365 R574Q probably damaging Het
Rap1gds1 T A 3: 139,050,553 T14S possibly damaging Het
Rbm11 A T 16: 75,600,797 K205M probably damaging Het
Rfx1 T A 8: 84,066,421 probably benign Het
Rnasel C A 1: 153,754,423 H228Q probably damaging Het
Sap130 T A 18: 31,698,587 I710K probably benign Het
Slc27a4 C A 2: 29,805,721 D89E probably benign Het
Spata31d1b T C 13: 59,715,965 V309A probably benign Het
Syt7 T G 19: 10,443,990 Y420D probably damaging Het
Tanc2 A G 11: 105,625,033 probably null Het
Tbc1d10b A G 7: 127,203,758 S333P possibly damaging Het
Tenm2 G A 11: 36,023,382 P2442S probably damaging Het
Tenm3 C T 8: 48,674,544 C33Y probably damaging Het
Timmdc1 A G 16: 38,499,057 L245P possibly damaging Het
Tlr5 T C 1: 182,972,447 F5L probably benign Het
Ttc25 C A 11: 100,569,853 probably null Het
Ttll4 T A 1: 74,687,840 F784L possibly damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Txndc17 T A 11: 72,208,745 N81K probably benign Het
Ubr3 C T 2: 70,000,551 probably benign Het
Uri1 A C 7: 37,981,691 V96G probably damaging Het
Uspl1 T A 5: 149,213,436 I482N probably damaging Het
Vmn1r229 A G 17: 20,814,712 N73S possibly damaging Het
Vwa7 G T 17: 35,024,412 G689* probably null Het
Zfp114 T A 7: 24,177,739 probably null Het
Zfp618 A G 4: 63,133,237 S659G probably damaging Het
Zfp872 A G 9: 22,200,053 K275R probably damaging Het
Zzef1 C T 11: 72,886,709 P1789S probably damaging Het
Other mutations in Mefv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mefv APN 16 3710960 missense probably benign 0.01
IGL00583:Mefv APN 16 3716072 nonsense probably null
IGL00963:Mefv APN 16 3715720 missense possibly damaging 0.83
IGL02185:Mefv APN 16 3715850 missense probably benign 0.09
IGL02500:Mefv APN 16 3713577 missense probably damaging 1.00
R0158:Mefv UTSW 16 3715456 missense possibly damaging 0.67
R1312:Mefv UTSW 16 3708534 splice site probably benign
R1956:Mefv UTSW 16 3717827 missense probably damaging 1.00
R2169:Mefv UTSW 16 3710888 missense probably benign 0.24
R2973:Mefv UTSW 16 3715694 nonsense probably null
R3723:Mefv UTSW 16 3708194 critical splice donor site probably null
R3724:Mefv UTSW 16 3708194 critical splice donor site probably null
R3953:Mefv UTSW 16 3715400 missense possibly damaging 0.60
R4276:Mefv UTSW 16 3715569 missense probably benign 0.41
R4650:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4651:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4652:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4670:Mefv UTSW 16 3708207 missense possibly damaging 0.67
R4781:Mefv UTSW 16 3715334 missense probably benign 0.00
R5593:Mefv UTSW 16 3715451 missense probably benign 0.00
R5834:Mefv UTSW 16 3716046 missense probably damaging 0.97
R5867:Mefv UTSW 16 3715933 missense probably damaging 1.00
R5954:Mefv UTSW 16 3715715 missense probably benign 0.09
R6056:Mefv UTSW 16 3708042 missense possibly damaging 0.73
R6260:Mefv UTSW 16 3713034 missense probably benign 0.03
R6409:Mefv UTSW 16 3710793 critical splice donor site probably null
R6511:Mefv UTSW 16 3715946 missense probably benign 0.00
R6666:Mefv UTSW 16 3707998 missense possibly damaging 0.88
R6952:Mefv UTSW 16 3710880 missense probably damaging 1.00
R7259:Mefv UTSW 16 3713053 missense probably damaging 1.00
R7410:Mefv UTSW 16 3715681 missense probably damaging 1.00
R7444:Mefv UTSW 16 3715522 missense probably benign 0.21
X0064:Mefv UTSW 16 3710841 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTCTGAATGGCTCCCCTAGAG -3'
(R):5'- CCAACTCGTTCAGCTAACTCAG -3'

Sequencing Primer
(F):5'- CTCCCCTAGAGCAAGAGATAAAGG -3'
(R):5'- CTTAATTTTAGAAATGCTGAGCTCTG -3'
Posted On2014-06-23