Incidental Mutation 'R0091:Usp46'
ID20199
Institutional Source Beutler Lab
Gene Symbol Usp46
Ensembl Gene ENSMUSG00000054814
Gene Nameubiquitin specific peptidase 46
Synonyms1190009E20Rik, 2410018I08Rik
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location73998453-74068431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74003257 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 246 (R246Q)
Ref Sequence ENSEMBL: ENSMUSP00000114060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068058] [ENSMUST00000119154]
Predicted Effect probably benign
Transcript: ENSMUST00000068058
AA Change: R273Q

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070554
Gene: ENSMUSG00000054814
AA Change: R273Q

DomainStartEndE-ValueType
Pfam:UCH 34 362 6.8e-67 PFAM
Pfam:UCH_1 35 335 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119154
AA Change: R246Q

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114060
Gene: ENSMUSG00000054814
AA Change: R246Q

DomainStartEndE-ValueType
Pfam:UCH 9 335 4.1e-67 PFAM
Pfam:UCH_1 11 308 2.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128750
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Usp46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Usp46 APN 5 74002686 missense probably null 0.03
IGL00401:Usp46 APN 5 74003171 missense probably damaging 1.00
IGL00949:Usp46 APN 5 74003242 missense possibly damaging 0.67
IGL02108:Usp46 APN 5 74029206 missense probably damaging 1.00
IGL02325:Usp46 APN 5 74037028 splice site probably null
IGL02383:Usp46 APN 5 74029353 missense probably benign 0.22
IGL02400:Usp46 APN 5 74037052 missense probably benign 0.00
IGL02833:Usp46 APN 5 74016682 missense probably benign 0.01
R1186:Usp46 UTSW 5 74002122 missense probably benign 0.01
R1714:Usp46 UTSW 5 74003167 missense probably benign 0.35
R4023:Usp46 UTSW 5 74032475 missense probably damaging 1.00
R4051:Usp46 UTSW 5 74002755 missense probably benign 0.01
R4239:Usp46 UTSW 5 74032267 unclassified probably benign
R4240:Usp46 UTSW 5 74032267 unclassified probably benign
R5542:Usp46 UTSW 5 74029241 missense probably benign 0.03
R5907:Usp46 UTSW 5 74037085 missense probably benign 0.05
R6442:Usp46 UTSW 5 74016716 missense probably benign 0.01
R6770:Usp46 UTSW 5 74032354 missense probably benign 0.00
R6856:Usp46 UTSW 5 74028934 unclassified probably benign
R7080:Usp46 UTSW 5 74016683 missense probably benign 0.31
R7430:Usp46 UTSW 5 74003188 missense probably damaging 1.00
R7475:Usp46 UTSW 5 74028937 nonsense probably null
R7782:Usp46 UTSW 5 74002111 missense probably benign 0.00
R8171:Usp46 UTSW 5 74002693 missense probably benign 0.04
R8695:Usp46 UTSW 5 74029236 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCACAATTCTGGCAGAGCACC -3'
(R):5'- CCATCTCACTCGGCGATTAACAGAC -3'

Sequencing Primer
(F):5'- AGTCAGGAGTTACTGTATACCTACTG -3'
(R):5'- AGACATGGGCATATCTTTCTGC -3'
Posted On2013-04-11