Incidental Mutation 'R1793:Piezo2'
ID 201999
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 039823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1793 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63106284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 510 (M510L)
Ref Sequence ENSEMBL: ENSMUSP00000138170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046860
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: M742L

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: M742L

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182166
Predicted Effect possibly damaging
Transcript: ENSMUST00000182233
AA Change: M510L

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: M510L

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183217
AA Change: M742L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: M742L

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,278 H571Q probably damaging Het
Abcf2 T A 5: 24,568,776 M372L probably benign Het
Acaca A C 11: 84,315,969 T1552P probably damaging Het
Acaca A G 11: 84,338,393 D1682G probably damaging Het
Acvr1b T C 15: 101,194,025 V62A probably benign Het
Aimp1 C T 3: 132,674,064 V97M probably benign Het
Aldh1l1 C T 6: 90,577,831 T557I possibly damaging Het
Alpk1 T C 3: 127,677,798 T1012A probably damaging Het
Amot G A X: 145,450,589 probably benign Het
Arap1 T A 7: 101,388,622 H477Q probably benign Het
Arhgap18 T A 10: 26,860,736 probably benign Het
Arhgef10l C T 4: 140,515,373 V862M probably damaging Het
Arl4d A G 11: 101,666,728 I27V probably benign Het
Asb18 G A 1: 90,014,555 P8L probably damaging Het
Ash1l A G 3: 89,070,309 H2682R probably damaging Het
Aspm T A 1: 139,457,341 V241E probably benign Het
Atf7ip G T 6: 136,609,219 probably benign Het
AY358078 T G 14: 51,804,594 M142R unknown Het
C3 T A 17: 57,219,592 K796N possibly damaging Het
Cd3eap T C 7: 19,357,979 T68A possibly damaging Het
Ceacam16 T C 7: 19,856,116 T301A probably damaging Het
Ceacam5 T G 7: 17,747,395 Y356D probably benign Het
Cep192 C T 18: 67,851,767 A1616V possibly damaging Het
Cherp A T 8: 72,463,150 H645Q probably benign Het
CK137956 T C 4: 127,951,449 D167G probably benign Het
Clcn1 T A 6: 42,298,926 probably null Het
Cntn1 C T 15: 92,291,671 T625I possibly damaging Het
Cpn2 T A 16: 30,259,324 N520Y probably damaging Het
Crocc G A 4: 141,019,309 R1762W probably damaging Het
Cts3 C A 13: 61,568,153 V100F probably benign Het
Ddx56 A T 11: 6,266,934 V87D probably damaging Het
Dnah9 C T 11: 66,119,594 probably null Het
Dock1 T A 7: 135,098,727 probably null Het
Dst T A 1: 34,152,471 Y291* probably null Het
Eif4g3 T C 4: 138,171,131 I1071T probably damaging Het
Fblim1 T C 4: 141,595,238 Q78R probably damaging Het
Fcamr C T 1: 130,811,547 P195S probably benign Het
Fcho1 G A 8: 71,709,022 Q835* probably null Het
Frem3 A G 8: 80,613,112 N678S probably benign Het
Frk G A 10: 34,607,882 R413H probably benign Het
Gm10619 C A 7: 73,810,010 noncoding transcript Het
Gm12185 G A 11: 48,915,756 R203* probably null Het
Gm12886 A G 4: 121,422,977 V34A probably benign Het
Gna12 A T 5: 140,760,952 I246N probably damaging Het
Gpm6a T C 8: 55,054,832 M201T probably benign Het
Gpsm2 T G 3: 108,700,909 D220A probably benign Het
Grip2 C G 6: 91,783,642 V325L probably benign Het
Grk5 C A 19: 61,076,762 A288D probably damaging Het
Herpud2 G A 9: 25,110,657 A231V possibly damaging Het
Hmcn1 T C 1: 150,749,083 S1024G probably benign Het
Hp1bp3 A G 4: 138,230,509 D295G probably damaging Het
Igsf21 T C 4: 140,034,392 H325R probably damaging Het
Ing2 T A 8: 47,669,329 L61F probably damaging Het
Jak3 T C 8: 71,685,946 probably benign Het
Kcnn3 T A 3: 89,609,405 C374S probably benign Het
Klk1b22 A G 7: 44,116,351 probably benign Het
Larp1 T C 11: 58,049,938 M630T possibly damaging Het
Lhx5 T A 5: 120,434,660 C115S probably damaging Het
Lmcd1 C A 6: 112,328,751 T271K probably benign Het
Lpar1 G A 4: 58,486,798 R158* probably null Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Maats1 T A 16: 38,321,419 N384Y possibly damaging Het
Map3k8 G A 18: 4,332,389 Q441* probably null Het
Mboat1 T C 13: 30,219,650 V144A probably damaging Het
Mcur1 C T 13: 43,560,015 G38S unknown Het
Med13 T A 11: 86,329,351 M276L probably benign Het
Mefv A G 16: 3,708,664 S699P possibly damaging Het
Mfsd4a C A 1: 132,059,339 A62S probably damaging Het
Mmp27 A G 9: 7,571,458 M1V probably null Het
Myo1c C T 11: 75,657,589 T58I probably damaging Het
Myom3 A T 4: 135,810,755 D1316V probably benign Het
Naa25 C A 5: 121,420,593 R333S probably damaging Het
Naa25 T A 5: 121,417,415 C235S possibly damaging Het
Nav3 G A 10: 109,703,372 T2056I probably benign Het
Nol4 A G 18: 22,769,821 Y378H probably damaging Het
Npat G A 9: 53,552,289 R124Q probably damaging Het
Npr3 T A 15: 11,848,579 E434V probably benign Het
Nptx2 A G 5: 144,548,320 T208A probably benign Het
Obscn C T 11: 59,077,780 V2798M probably damaging Het
Olfr1406 A T 1: 173,184,409 H8Q probably benign Het
Olfr1484 C T 19: 13,585,415 T37I probably benign Het
Olfr569 A G 7: 102,888,043 Y37H probably benign Het
Padi1 G A 4: 140,814,656 P652S probably damaging Het
Pcdh1 G T 18: 38,198,885 P355Q probably damaging Het
Pck2 G A 14: 55,543,965 R189H possibly damaging Het
Pcsk5 T A 19: 17,454,750 K1500N possibly damaging Het
Phc3 A T 3: 30,948,716 S218T probably damaging Het
Ppp1r3a A T 6: 14,754,718 Y177N probably damaging Het
Psme2b A T 11: 48,945,534 D195E probably damaging Het
Ptprr T C 10: 116,252,922 V463A probably damaging Het
Pwwp2b G A 7: 139,256,365 R574Q probably damaging Het
Rap1gds1 T A 3: 139,050,553 T14S possibly damaging Het
Rbm11 A T 16: 75,600,797 K205M probably damaging Het
Rfx1 T A 8: 84,066,421 probably benign Het
Rnasel C A 1: 153,754,423 H228Q probably damaging Het
Sap130 T A 18: 31,698,587 I710K probably benign Het
Slc27a4 C A 2: 29,805,721 D89E probably benign Het
Spata31d1b T C 13: 59,715,965 V309A probably benign Het
Syt7 T G 19: 10,443,990 Y420D probably damaging Het
Tanc2 A G 11: 105,625,033 probably null Het
Tbc1d10b A G 7: 127,203,758 S333P possibly damaging Het
Tenm2 G A 11: 36,023,382 P2442S probably damaging Het
Tenm3 C T 8: 48,674,544 C33Y probably damaging Het
Timmdc1 A G 16: 38,499,057 L245P possibly damaging Het
Tlr5 T C 1: 182,972,447 F5L probably benign Het
Ttc25 C A 11: 100,569,853 probably null Het
Ttll4 T A 1: 74,687,840 F784L possibly damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Txndc17 T A 11: 72,208,745 N81K probably benign Het
Ubr3 C T 2: 70,000,551 probably benign Het
Uri1 A C 7: 37,981,691 V96G probably damaging Het
Uspl1 T A 5: 149,213,436 I482N probably damaging Het
Vmn1r229 A G 17: 20,814,712 N73S possibly damaging Het
Vwa7 G T 17: 35,024,412 G689* probably null Het
Zfp114 T A 7: 24,177,739 probably null Het
Zfp618 A G 4: 63,133,237 S659G probably damaging Het
Zfp872 A G 9: 22,200,053 K275R probably damaging Het
Zzef1 C T 11: 72,886,709 P1789S probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
sopranino UTSW 18 63024466 missense probably damaging 1.00
woodwind UTSW 18 63124642 missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63017519 splice site probably null
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63053010 missense probably benign 0.01
R7612:Piezo2 UTSW 18 63042539 missense probably benign 0.12
R7829:Piezo2 UTSW 18 63113876 critical splice donor site probably null
R7835:Piezo2 UTSW 18 63082945 missense probably benign 0.12
R8014:Piezo2 UTSW 18 63083200 missense probably benign 0.02
R8055:Piezo2 UTSW 18 63042811 missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63030466 missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63075730 missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63012786 missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63084688 missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63045540 missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63146802 missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63092900 nonsense probably null
R8708:Piezo2 UTSW 18 63093015 missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63109885 missense probably benign
R8727:Piezo2 UTSW 18 63109885 missense probably benign
R8810:Piezo2 UTSW 18 63114963 missense probably benign 0.41
R8900:Piezo2 UTSW 18 63115025 missense probably benign 0.04
R9037:Piezo2 UTSW 18 63092831 missense probably benign 0.31
R9079:Piezo2 UTSW 18 63024466 missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9125:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9171:Piezo2 UTSW 18 63045479 missense probably benign 0.04
R9194:Piezo2 UTSW 18 63117744 missense probably benign 0.03
R9203:Piezo2 UTSW 18 63157231 missense probably benign 0.00
R9209:Piezo2 UTSW 18 63021301 missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63075797 missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63024566 missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63029085 missense possibly damaging 0.48
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCATCGAGGCTTTTAATGTG -3'
(R):5'- GGCGCATTGTCACAAGTAAAC -3'

Sequencing Primer
(F):5'- CATCGAGGCTTTTAATGTGTTTGTC -3'
(R):5'- GCATTGTCACAAGTAAACTGCAC -3'
Posted On 2014-06-23