Incidental Mutation 'R1794:Olfr1263'
ID202022
Institutional Source Beutler Lab
Gene Symbol Olfr1263
Ensembl Gene ENSMUSG00000059112
Gene Nameolfactory receptor 1263
SynonymsMOR234-2, GA_x6K02T2Q125-51447049-51447969
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1794 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90012131-90018424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90015020 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 30 (Y30C)
Ref Sequence ENSEMBL: ENSMUSP00000150959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111507] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably damaging
Transcript: ENSMUST00000111507
AA Change: Y30C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107132
Gene: ENSMUSG00000059112
AA Change: Y30C

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 7.6e-42 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.7e-5 PFAM
Pfam:7tm_1 36 282 2.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214382
AA Change: Y30C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216764
Predicted Effect probably damaging
Transcript: ENSMUST00000217065
AA Change: Y30C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Olfr1263
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Olfr1263 APN 2 90015719 missense probably damaging 1.00
IGL01512:Olfr1263 APN 2 90015292 missense probably damaging 1.00
IGL01722:Olfr1263 APN 2 90015007 missense probably benign 0.39
IGL01787:Olfr1263 APN 2 90015311 missense probably damaging 1.00
IGL02376:Olfr1263 APN 2 90015460 missense probably benign 0.00
IGL03408:Olfr1263 APN 2 90015571 missense probably benign 0.35
R0367:Olfr1263 UTSW 2 90015772 missense probably damaging 0.99
R0765:Olfr1263 UTSW 2 90015670 missense probably benign 0.01
R1158:Olfr1263 UTSW 2 90015254 missense possibly damaging 0.94
R1705:Olfr1263 UTSW 2 90015511 missense possibly damaging 0.90
R2197:Olfr1263 UTSW 2 90015424 missense probably damaging 1.00
R2347:Olfr1263 UTSW 2 90015614 missense possibly damaging 0.82
R2442:Olfr1263 UTSW 2 90015341 missense probably benign
R3160:Olfr1263 UTSW 2 90015021 nonsense probably null
R3162:Olfr1263 UTSW 2 90015021 nonsense probably null
R4298:Olfr1263 UTSW 2 90015649 missense probably benign 0.13
R4898:Olfr1263 UTSW 2 90015418 missense probably damaging 1.00
R5340:Olfr1263 UTSW 2 90015362 missense probably benign
R6280:Olfr1263 UTSW 2 90015049 missense possibly damaging 0.62
R6367:Olfr1263 UTSW 2 90015016 missense probably benign 0.00
R6556:Olfr1263 UTSW 2 90015094 missense probably damaging 1.00
R7086:Olfr1263 UTSW 2 90015250 missense probably benign 0.07
R7502:Olfr1263 UTSW 2 90015011 missense probably benign 0.15
R7585:Olfr1263 UTSW 2 90015049 missense probably damaging 0.99
R8062:Olfr1263 UTSW 2 90015736 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCTGCATGGGATGTGATAC -3'
(R):5'- CAGCCATTGAAGGATATGGTGC -3'

Sequencing Primer
(F):5'- TGATACTGAGAAGAAATGCAGCTAC -3'
(R):5'- CCATTGAAGGATATGGTGCTCTTCTC -3'
Posted On2014-06-23