Incidental Mutation 'R1794:Rnf220'
ID 202031
Institutional Source Beutler Lab
Gene Symbol Rnf220
Ensembl Gene ENSMUSG00000028677
Gene Name ring finger protein 220
Synonyms
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock # R1794 (G1)
Quality Score 135
Status Not validated
Chromosome 4
Chromosomal Location 117271463-117497052 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 117307568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 7 (Q7K)
Ref Sequence ENSEMBL: ENSMUSP00000092449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030439] [ENSMUST00000094853]
AlphaFold Q6PDX6
Predicted Effect probably benign
Transcript: ENSMUST00000030439
AA Change: Q246K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030439
Gene: ENSMUSG00000028677
AA Change: Q246K

DomainStartEndE-ValueType
Pfam:RNF220 217 339 3.5e-38 PFAM
Pfam:RNF220 325 444 4.9e-51 PFAM
RING 514 552 1.62e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094853
AA Change: Q7K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092449
Gene: ENSMUSG00000028677
AA Change: Q7K

DomainStartEndE-ValueType
low complexity region 176 187 N/A INTRINSIC
RING 301 339 1.62e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138435
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Rnf220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rnf220 APN 4 117307675 missense probably benign 0.02
IGL01345:Rnf220 APN 4 117273270 nonsense probably null
IGL02097:Rnf220 APN 4 117273327 missense probably benign 0.00
IGL02245:Rnf220 APN 4 117299537 splice site probably benign
IGL02366:Rnf220 APN 4 117489783 missense probably benign
IGL02725:Rnf220 APN 4 117272379 splice site probably benign
IGL02801:Rnf220 APN 4 117273251 missense probably damaging 1.00
IGL02963:Rnf220 APN 4 117490192 missense probably damaging 0.97
BB007:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
BB017:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
PIT4131001:Rnf220 UTSW 4 117277369 critical splice donor site probably null
R0041:Rnf220 UTSW 4 117273284 missense probably damaging 1.00
R0784:Rnf220 UTSW 4 117277998 splice site probably benign
R1107:Rnf220 UTSW 4 117285390 missense probably damaging 1.00
R1122:Rnf220 UTSW 4 117278080 missense probably benign 0.01
R1231:Rnf220 UTSW 4 117489884 missense probably damaging 0.98
R1708:Rnf220 UTSW 4 117489886 missense probably benign 0.00
R4488:Rnf220 UTSW 4 117489814 missense probably damaging 1.00
R4710:Rnf220 UTSW 4 117289214 unclassified probably benign
R4790:Rnf220 UTSW 4 117289055 missense probably benign 0.45
R4923:Rnf220 UTSW 4 117489600 missense possibly damaging 0.71
R5173:Rnf220 UTSW 4 117289274 start gained probably benign
R5334:Rnf220 UTSW 4 117272351 missense probably damaging 1.00
R5505:Rnf220 UTSW 4 117296091 intron probably benign
R5849:Rnf220 UTSW 4 117277612 missense possibly damaging 0.92
R7075:Rnf220 UTSW 4 117285882 missense probably benign 0.28
R7349:Rnf220 UTSW 4 117277818 missense probably damaging 0.99
R7478:Rnf220 UTSW 4 117296136 missense possibly damaging 0.94
R7541:Rnf220 UTSW 4 117489930 missense probably damaging 1.00
R7930:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
R8030:Rnf220 UTSW 4 117277828 missense probably damaging 1.00
R8202:Rnf220 UTSW 4 117489873 missense probably damaging 1.00
R8701:Rnf220 UTSW 4 117489993 missense probably damaging 0.99
R9268:Rnf220 UTSW 4 117489636 missense probably benign 0.09
R9452:Rnf220 UTSW 4 117296142 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTCTTATTCTGAGGCTGGAGC -3'
(R):5'- AAGGCCTAGGATACAGGATTCC -3'

Sequencing Primer
(F):5'- CTGGAGCCTGAGGATTCACTTC -3'
(R):5'- AGGATACAGGATTCCCTTCTACTGAC -3'
Posted On 2014-06-23