Incidental Mutation 'R1794:March1'
ID 202049
Institutional Source Beutler Lab
Gene Symbol March1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane-associated ring finger (C3HC4) 1
Synonyms
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R1794 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 65617900-66471637 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66386942 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 126 (Y126N)
Ref Sequence ENSEMBL: ENSMUSP00000105885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
AlphaFold Q6NZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000039540
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072482
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098708
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110255
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110256
AA Change: Y126N

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: Y126N

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110258
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110259
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably benign
Transcript: ENSMUST00000178982
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in March1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:March1 APN 8 66418877 missense possibly damaging 0.88
IGL02468:March1 APN 8 66418911 missense probably damaging 1.00
R0391:March1 UTSW 8 66418973 missense probably damaging 1.00
R1500:March1 UTSW 8 66468390 missense probably damaging 1.00
R2015:March1 UTSW 8 66121821 missense probably damaging 0.99
R2184:March1 UTSW 8 66387423 missense probably benign 0.07
R2273:March1 UTSW 8 66387499 missense probably benign 0.15
R2274:March1 UTSW 8 66387499 missense probably benign 0.15
R2275:March1 UTSW 8 66387499 missense probably benign 0.15
R2314:March1 UTSW 8 66121790 start codon destroyed probably null 0.77
R3114:March1 UTSW 8 66387381 missense probably benign
R4458:March1 UTSW 8 66456171 missense probably damaging 1.00
R4656:March1 UTSW 8 66386419 missense probably benign 0.05
R4773:March1 UTSW 8 66387224 missense probably benign 0.03
R4838:March1 UTSW 8 66468363 missense probably damaging 1.00
R5073:March1 UTSW 8 66386368 missense probably benign 0.03
R5507:March1 UTSW 8 66418890 missense probably damaging 1.00
R5575:March1 UTSW 8 66468310 missense probably damaging 1.00
R5916:March1 UTSW 8 66387111 missense possibly damaging 0.89
R6931:March1 UTSW 8 66468492 missense probably benign 0.03
R7350:March1 UTSW 8 66468399 nonsense probably null
R7487:March1 UTSW 8 66456074 missense probably benign 0.14
R7531:March1 UTSW 8 66386337 missense probably benign
R7563:March1 UTSW 8 66468313 missense probably damaging 1.00
R7705:March1 UTSW 8 66468517 missense probably benign 0.00
R8142:March1 UTSW 8 66456126 missense probably benign 0.07
R8337:March1 UTSW 8 66418989 missense probably damaging 1.00
R8712:March1 UTSW 8 66468348 missense probably damaging 1.00
R9188:March1 UTSW 8 66456151 nonsense probably null
R9372:March1 UTSW 8 66468493 missense probably benign 0.01
R9477:March1 UTSW 8 66418890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACTTCTGGTCATACTGTCATG -3'
(R):5'- ATTTCTCCTTCGCCGAGACAG -3'

Sequencing Primer
(F):5'- GGTCATACTGTCATGTTCATCATTC -3'
(R):5'- CCGAGACAGTCTGAATTTAACCTGG -3'
Posted On 2014-06-23