Incidental Mutation 'R1794:Dis3l'
ID 202056
Institutional Source Beutler Lab
Gene Symbol Dis3l
Ensembl Gene ENSMUSG00000032396
Gene Name DIS3 like exosome 3'-5' exoribonuclease
Synonyms
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock # R1794 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 64306756-64341288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 64317776 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 413 (V413G)
Ref Sequence ENSEMBL: ENSMUSP00000129772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068367] [ENSMUST00000113890] [ENSMUST00000120760] [ENSMUST00000168844]
AlphaFold Q8C0S1
Predicted Effect possibly damaging
Transcript: ENSMUST00000068367
AA Change: V330G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063830
Gene: ENSMUSG00000032396
AA Change: V330G

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113890
AA Change: V330G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109522
Gene: ENSMUSG00000032396
AA Change: V330G

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120760
AA Change: V330G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113503
Gene: ENSMUSG00000032396
AA Change: V330G

DomainStartEndE-ValueType
low complexity region 125 137 N/A INTRINSIC
RNB 382 734 4.82e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168844
AA Change: V413G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129772
Gene: ENSMUSG00000032396
AA Change: V413G

DomainStartEndE-ValueType
low complexity region 208 220 N/A INTRINSIC
RNB 465 817 4.82e-127 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic RNA exosome complex degrades unstable mRNAs and is involved in the regular turnover of other mRNAs. The protein encoded by this gene contains 3'-5' exoribonuclease activity and is a catalytic component of this complex. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Dis3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Dis3l APN 9 64319254 critical splice acceptor site probably null
IGL01812:Dis3l APN 9 64310237 missense probably benign 0.00
IGL01838:Dis3l APN 9 64308299 missense probably benign 0.41
IGL02104:Dis3l APN 9 64310329 missense possibly damaging 0.61
IGL02478:Dis3l APN 9 64314773 missense probably benign 0.00
IGL02481:Dis3l APN 9 64319080 splice site probably null
IGL02483:Dis3l APN 9 64319080 splice site probably null
IGL02965:Dis3l APN 9 64310484 missense probably damaging 0.99
IGL03139:Dis3l APN 9 64311950 missense probably damaging 0.99
IGL03054:Dis3l UTSW 9 64310440 critical splice donor site probably null
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0066:Dis3l UTSW 9 64319165 missense probably benign 0.27
R0724:Dis3l UTSW 9 64307126 missense possibly damaging 0.92
R0801:Dis3l UTSW 9 64319154 missense probably benign
R0925:Dis3l UTSW 9 64341130 start codon destroyed probably null 0.97
R1502:Dis3l UTSW 9 64325787 missense possibly damaging 0.68
R1541:Dis3l UTSW 9 64307489 missense probably benign 0.07
R1929:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2007:Dis3l UTSW 9 64308276 splice site probably null
R2062:Dis3l UTSW 9 64339573 missense probably benign 0.02
R2152:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2153:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2154:Dis3l UTSW 9 64307263 missense probably benign 0.00
R2186:Dis3l UTSW 9 64339612 nonsense probably null
R2271:Dis3l UTSW 9 64330883 missense probably damaging 0.96
R2280:Dis3l UTSW 9 64317794 missense possibly damaging 0.70
R2287:Dis3l UTSW 9 64307497 missense probably benign 0.20
R3156:Dis3l UTSW 9 64311750 missense probably benign 0.25
R4664:Dis3l UTSW 9 64330798 missense unknown
R4775:Dis3l UTSW 9 64330908 missense probably benign 0.16
R4977:Dis3l UTSW 9 64307201 missense probably benign 0.00
R4997:Dis3l UTSW 9 64311942 missense possibly damaging 0.76
R5097:Dis3l UTSW 9 64319216 missense probably damaging 1.00
R5579:Dis3l UTSW 9 64330835 missense probably benign 0.44
R5623:Dis3l UTSW 9 64307603 missense possibly damaging 0.70
R6310:Dis3l UTSW 9 64322575 missense probably benign 0.00
R6442:Dis3l UTSW 9 64307555 missense probably benign
R6505:Dis3l UTSW 9 64307513 missense probably benign 0.15
R6731:Dis3l UTSW 9 64310438 splice site probably null
R7008:Dis3l UTSW 9 64310453 missense possibly damaging 0.96
R7405:Dis3l UTSW 9 64314704 missense probably damaging 1.00
R7555:Dis3l UTSW 9 64311937 nonsense probably null
R7798:Dis3l UTSW 9 64341017 missense probably benign
R7890:Dis3l UTSW 9 64322471 missense probably benign 0.00
R8329:Dis3l UTSW 9 64311830 missense possibly damaging 0.50
R8715:Dis3l UTSW 9 64307060 missense probably benign
R8942:Dis3l UTSW 9 64307593 missense probably benign 0.22
R8973:Dis3l UTSW 9 64339542 missense probably damaging 0.96
R9189:Dis3l UTSW 9 64310449 missense probably benign 0.21
R9240:Dis3l UTSW 9 64310165 critical splice donor site probably null
R9354:Dis3l UTSW 9 64314640 missense probably benign 0.01
R9394:Dis3l UTSW 9 64317735 missense probably benign 0.24
R9569:Dis3l UTSW 9 64329547 missense unknown
X0020:Dis3l UTSW 9 64325734 missense probably damaging 1.00
X0065:Dis3l UTSW 9 64307054 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGACCTCTGGCCTCCATAT -3'
(R):5'- CCAGAGAGCAGAGTAAGCCTC -3'

Sequencing Primer
(F):5'- GCATGCACAATTACTCGAGTGTG -3'
(R):5'- AGTAAGCCTCTGCAAGCCG -3'
Posted On 2014-06-23