Mutagenetix > Incidental Mutations

Incidental Mutation 'R1794:Ros1'

202060

Institutional Source

Beutler Lab

Gene Symbol

Ros1

Ensembl Gene

ENSMUSG00000019893

Gene Name

Ros1 proto-oncogene

Synonyms

Ros-1, c-ros

MMRRC Submission

039824-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R1794 (G1)

Quality Score

151

Status

Not validated

Chromosome

Chromosomal Location

52045721-52195244 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 52124103 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1109 (K1109*)

Ref Sequence

ENSEMBL: ENSMUSP00000151615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]

Predicted Effect

probably null
Transcript: ENSMUST00000020045
AA Change: K1130*

SMART Domains

Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: K1130*

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	568	654	2.24e-4	SMART
LY	734	776	2.28e1	SMART
LY	777	815	4.61e0	SMART
FN3	944	1023	5.53e-4	SMART
FN3	1037	1133	1.07e1	SMART
FN3	1440	1532	1.19e1	SMART
FN3	1551	1637	2.11e0	SMART
FN3	1649	1731	6.8e-4	SMART
FN3	1746	1832	2.7e1	SMART
TyrKc	1938	2208	1.3e-145	SMART
low complexity region	2294	2307	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117992
AA Change: K1109*

SMART Domains

Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: K1109*

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
TyrKc	1917	2187	1.3e-145	SMART
low complexity region	2273	2286	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000177378
AA Change: K1109*

SMART Domains

Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: K1109*

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
Blast:LY	1190	1236	2e-18	BLAST
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
transmembrane domain	1832	1854	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177387

Predicted Effect

probably null
Transcript: ENSMUST00000218452
AA Change: K1109*

Predicted Effect

probably null
Transcript: ENSMUST00000219173
AA Change: K1109*

Predicted Effect

probably benign
Transcript: ENSMUST00000219692

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,620	E44G	probably benign	Het
Anxa7	A	G	14: 20,471,467	Y54H	unknown	Het
Arhgef3	A	G	14: 27,397,605	T331A	probably benign	Het
Arhgef40	G	T	14: 51,989,930	C477F	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp13a5	C	A	16: 29,321,709	R343L	probably damaging	Het
Brdt	ACAGCAGCAGCAGCAGC	ACAGCAGCAGCAGC	5: 107,359,853		probably benign	Het
Btbd2	G	T	10: 80,643,913	D426E	probably damaging	Het
Cabin1	A	C	10: 75,725,745	I974R	possibly damaging	Het
Cacna1i	G	A	15: 80,389,122	V1670M	probably damaging	Het
Cc2d2a	C	A	5: 43,688,252	Q288K	probably damaging	Het
Ccl20	T	A	1: 83,117,829	I37K	possibly damaging	Het
Cdcp1	A	G	9: 123,190,094	V40A	probably benign	Het
Cdcp1	T	C	9: 123,215,831	T27A	probably benign	Het
Cdh4	C	T	2: 179,886,842	T581I	probably damaging	Het
Cgn	A	G	3: 94,762,557		probably null	Het
Col7a1	G	A	9: 108,965,928	G1493D	unknown	Het
Creb3	A	G	4: 43,563,302	E133G	probably benign	Het
Dchs1	T	C	7: 105,771,720	T498A	probably benign	Het
Dis3l	A	C	9: 64,317,776	V413G	possibly damaging	Het
Dnah6	T	C	6: 73,024,958	E3865G	probably damaging	Het
Fam219b	A	G	9: 57,539,281	Y139C	probably damaging	Het
Fat3	A	T	9: 15,997,136	Y2523*	probably null	Het
Fat3	A	T	9: 15,997,138	Y2523N	probably benign	Het
Fmnl1	T	C	11: 103,197,147	S40P	probably benign	Het
Gm17727	T	A	9: 35,777,122	I56F	probably benign	Het
Gm4792	T	C	10: 94,298,490	D6G	unknown	Het
Hhat	G	T	1: 192,693,906	Y306*	probably null	Het
Hmcn1	A	G	1: 150,598,285	I4802T	probably benign	Het
Hmcn1	G	A	1: 150,627,152	T3908I	probably damaging	Het
Hsph1	A	T	5: 149,630,773	N79K	probably damaging	Het
Ikbke	T	A	1: 131,259,218	Y579F	probably damaging	Het
Jak2	A	G	19: 29,299,557	D838G	probably benign	Het
Klhdc7b	T	C	15: 89,387,020	S702P	probably benign	Het
Lingo3	C	A	10: 80,835,598	R166L	probably benign	Het
Lins1	T	C	7: 66,711,909	F436S	probably damaging	Het
Lman1	T	C	18: 65,991,684	D328G	probably benign	Het
Lox	A	G	18: 52,528,307	C232R	probably damaging	Het
Lrrc59	T	C	11: 94,638,595	V165A	probably benign	Het
Map9	A	G	3: 82,380,221	D50G	probably damaging	Het
March1	T	A	8: 66,386,942	Y126N	possibly damaging	Het
Mcf2l	T	C	8: 12,915,982	F3L	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nin	G	A	12: 70,043,795	Q949*	probably null	Het
Nlgn3	A	G	X: 101,320,033	H636R	probably benign	Het
Notch2	A	G	3: 98,099,547	D411G	possibly damaging	Het
Olfr1263	A	G	2: 90,015,020	Y30C	probably damaging	Het
Olfr1449	G	C	19: 12,934,968	A77P	probably damaging	Het
Plekha7	A	G	7: 116,140,681	V579A	probably damaging	Het
Prrc2c	T	C	1: 162,705,959		probably benign	Het
Rab7b	T	C	1: 131,697,068		probably null	Het
Reg3b	G	T	6: 78,372,214		probably null	Het
Rgs20	A	G	1: 4,910,572	Y177H	probably damaging	Het
Ripk3	G	T	14: 55,785,329	N379K	probably benign	Het
Rnf220	G	T	4: 117,307,568	Q7K	probably benign	Het
Slc22a7	T	G	17: 46,433,153	R460S	probably damaging	Het
Slc4a2	A	G	5: 24,439,328	M975V	probably damaging	Het
Slc4a3	A	T	1: 75,557,308	I1100F	probably damaging	Het
Smco1	A	G	16: 32,274,132	E207G	probably benign	Het
Snrnp200	A	G	2: 127,216,736	E369G	probably benign	Het
Tcf4	T	A	18: 69,657,853	M178K	probably benign	Het
Tex2	T	C	11: 106,567,902		probably benign	Het
Tjp1	A	T	7: 65,323,129	I521N	probably damaging	Het
Tmem203	A	G	2: 25,255,994	T109A	probably benign	Het
Tmem50b	T	C	16: 91,578,029	I126V	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	T	C	1: 188,862,809	F3813L	probably benign	Het
Vmn1r203	C	T	13: 22,524,351	R101W	probably damaging	Het
Vmn2r79	G	A	7: 87,001,413	V136I	probably benign	Het
Wdr38	A	G	2: 39,000,729	Y205C	probably damaging	Het
Zfp248	A	G	6: 118,429,303	F442L	probably damaging	Het
Znrf4	A	G	17: 56,511,599	I236T	probably damaging	Het

Other mutations in Ros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ros1	APN	10	52194890	missense	probably benign	0.01
IGL00338:Ros1	APN	10	52125811	missense	probably benign
IGL00419:Ros1	APN	10	52091054	missense	probably damaging	0.97
IGL00840:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00841:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00951:Ros1	APN	10	52143252	missense	probably damaging	0.99
IGL01123:Ros1	APN	10	52120809	missense	probably damaging	1.00
IGL01128:Ros1	APN	10	52142328	nonsense	probably null
IGL01300:Ros1	APN	10	52101713	missense	probably benign	0.01
IGL01316:Ros1	APN	10	52087879	critical splice donor site	probably null
IGL01349:Ros1	APN	10	52051026	missense	probably damaging	0.99
IGL01363:Ros1	APN	10	52166142	missense	probably damaging	1.00
IGL01457:Ros1	APN	10	52046330	splice site	probably benign
IGL01532:Ros1	APN	10	52090938	splice site	probably benign
IGL01585:Ros1	APN	10	52155102	missense	probably damaging	1.00
IGL01650:Ros1	APN	10	52154979	missense	probably damaging	0.99
IGL01672:Ros1	APN	10	52101803	missense	possibly damaging	0.92
IGL01904:Ros1	APN	10	52077911	missense	probably damaging	0.97
IGL02040:Ros1	APN	10	52115922	missense	probably damaging	0.99
IGL02053:Ros1	APN	10	52162720	missense	probably damaging	1.00
IGL02147:Ros1	APN	10	52120895	missense	probably damaging	1.00
IGL02169:Ros1	APN	10	52081957	critical splice donor site	probably null
IGL02247:Ros1	APN	10	52129581	missense	probably damaging	0.99
IGL02262:Ros1	APN	10	52178969	missense	probably damaging	0.96
IGL02307:Ros1	APN	10	52128438	missense	possibly damaging	0.53
IGL02398:Ros1	APN	10	52144884	splice site	probably benign
IGL02525:Ros1	APN	10	52116042	missense	possibly damaging	0.66
IGL02718:Ros1	APN	10	52118232	missense	probably damaging	1.00
IGL02721:Ros1	APN	10	52172831	splice site	probably benign
IGL02808:Ros1	APN	10	52125889	missense	probably damaging	1.00
IGL03009:Ros1	APN	10	52145907	missense	probably benign	0.00
IGL03035:Ros1	APN	10	52075984	splice site	probably benign
IGL03092:Ros1	APN	10	52098806	missense	probably damaging	0.99
IGL03309:Ros1	APN	10	52118261	missense	possibly damaging	0.83
IGL03333:Ros1	APN	10	52155171	missense	probably damaging	1.00
boss	UTSW	10	52090995	nonsense	probably null
Chuckwagon	UTSW	10	52118203	missense	probably damaging	1.00
trail	UTSW	10	52161895	nonsense	probably null
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0125:Ros1	UTSW	10	52125789	missense	probably benign	0.38
R0403:Ros1	UTSW	10	52143438	splice site	probably benign
R0487:Ros1	UTSW	10	52155108	missense	possibly damaging	0.69
R0502:Ros1	UTSW	10	52194823	splice site	probably benign
R0557:Ros1	UTSW	10	52085263	missense	possibly damaging	0.82
R0599:Ros1	UTSW	10	52123300	missense	probably damaging	1.00
R0620:Ros1	UTSW	10	52118348	missense	probably damaging	1.00
R0679:Ros1	UTSW	10	52066295	missense	possibly damaging	0.95
R1005:Ros1	UTSW	10	52128405	splice site	probably benign
R1073:Ros1	UTSW	10	52046125	missense	probably damaging	1.00
R1220:Ros1	UTSW	10	52098870	missense	probably damaging	0.97
R1279:Ros1	UTSW	10	52142166	missense	possibly damaging	0.81
R1295:Ros1	UTSW	10	52087932	missense	possibly damaging	0.92
R1336:Ros1	UTSW	10	52168662	missense	probably damaging	1.00
R1371:Ros1	UTSW	10	52087945	missense	probably damaging	0.98
R1447:Ros1	UTSW	10	52098858	missense	possibly damaging	0.66
R1486:Ros1	UTSW	10	52172858	missense	probably damaging	1.00
R1499:Ros1	UTSW	10	52098677	missense	possibly damaging	0.92
R1669:Ros1	UTSW	10	52161811	missense	probably damaging	1.00
R1744:Ros1	UTSW	10	52123379	missense	probably damaging	0.99
R1759:Ros1	UTSW	10	52120826	missense	probably damaging	1.00
R1791:Ros1	UTSW	10	52100087	missense	probably benign	0.00
R2031:Ros1	UTSW	10	52067068	missense	possibly damaging	0.88
R2115:Ros1	UTSW	10	52128555	missense	probably benign	0.00
R2219:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R2290:Ros1	UTSW	10	52118381	missense	probably damaging	0.96
R2329:Ros1	UTSW	10	52162887	missense	probably damaging	1.00
R2371:Ros1	UTSW	10	52163895	missense	possibly damaging	0.66
R2879:Ros1	UTSW	10	52172840	critical splice donor site	probably null
R3154:Ros1	UTSW	10	52050981	missense	probably benign
R3423:Ros1	UTSW	10	52128416	splice site	probably null
R3424:Ros1	UTSW	10	52128416	splice site	probably null
R3425:Ros1	UTSW	10	52128416	splice site	probably null
R3433:Ros1	UTSW	10	52091108	missense	probably benign	0.45
R3522:Ros1	UTSW	10	52090995	nonsense	probably null
R3686:Ros1	UTSW	10	52145816	missense	probably damaging	1.00
R3710:Ros1	UTSW	10	52161895	nonsense	probably null
R3771:Ros1	UTSW	10	52128991	missense	probably damaging	0.97
R3808:Ros1	UTSW	10	52120848	missense	probably benign	0.08
R3930:Ros1	UTSW	10	52194848	missense	possibly damaging	0.92
R3950:Ros1	UTSW	10	52066388	missense	probably damaging	1.00
R3981:Ros1	UTSW	10	52120878	missense	possibly damaging	0.46
R4007:Ros1	UTSW	10	52118232	missense	probably damaging	1.00
R4346:Ros1	UTSW	10	52168609	missense	possibly damaging	0.92
R4382:Ros1	UTSW	10	52120959	missense	possibly damaging	0.46
R4414:Ros1	UTSW	10	52162704	critical splice donor site	probably null
R4450:Ros1	UTSW	10	52077942	missense	probably damaging	0.98
R4468:Ros1	UTSW	10	52118356	missense	probably damaging	1.00
R4569:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R4649:Ros1	UTSW	10	52129668	missense	possibly damaging	0.66
R4684:Ros1	UTSW	10	52129096	missense	probably damaging	1.00
R4706:Ros1	UTSW	10	52101894	missense	possibly damaging	0.95
R4731:Ros1	UTSW	10	52142229	missense	probably damaging	1.00
R4748:Ros1	UTSW	10	52115997	missense	probably benign	0.00
R4806:Ros1	UTSW	10	52096175	missense	probably damaging	0.96
R4865:Ros1	UTSW	10	52172870	missense	probably damaging	0.99
R4973:Ros1	UTSW	10	52154991	missense	probably damaging	0.98
R5022:Ros1	UTSW	10	52124075	missense	possibly damaging	0.46
R5033:Ros1	UTSW	10	52128416	critical splice donor site	probably null
R5082:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5083:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5130:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5269:Ros1	UTSW	10	52051008	missense	probably damaging	1.00
R5399:Ros1	UTSW	10	52090944	critical splice donor site	probably null
R5414:Ros1	UTSW	10	52155093	missense	probably damaging	1.00
R5659:Ros1	UTSW	10	52143386	missense	possibly damaging	0.92
R5742:Ros1	UTSW	10	52142138	critical splice donor site	probably null
R5780:Ros1	UTSW	10	52194857	missense	probably damaging	1.00
R5805:Ros1	UTSW	10	52123289	missense	probably damaging	1.00
R5843:Ros1	UTSW	10	52166197	missense	possibly damaging	0.92
R5881:Ros1	UTSW	10	52181798	missense	probably benign	0.26
R6027:Ros1	UTSW	10	52163968	missense	possibly damaging	0.82
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6052:Ros1	UTSW	10	52163903	missense	probably benign	0.39
R6175:Ros1	UTSW	10	52101785	missense	probably benign	0.02
R6315:Ros1	UTSW	10	52118210	missense	probably benign
R6342:Ros1	UTSW	10	52155255	missense	probably damaging	1.00
R6470:Ros1	UTSW	10	52166044	critical splice donor site	probably null
R6527:Ros1	UTSW	10	52143377	missense	possibly damaging	0.66
R6568:Ros1	UTSW	10	52162812	missense	probably damaging	1.00
R6573:Ros1	UTSW	10	52155010	missense	possibly damaging	0.84
R6653:Ros1	UTSW	10	52142203	missense	probably damaging	1.00
R6959:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R7011:Ros1	UTSW	10	52180176	missense	probably damaging	1.00
R7111:Ros1	UTSW	10	52181810	missense	probably benign	0.02
R7243:Ros1	UTSW	10	52123381	missense	probably damaging	1.00
R7355:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R7385:Ros1	UTSW	10	52155126	missense	probably benign	0.00
R7460:Ros1	UTSW	10	52118203	missense	probably damaging	1.00
R7549:Ros1	UTSW	10	52145834	missense	probably damaging	0.96
R7573:Ros1	UTSW	10	52169976	missense	probably benign	0.03
R7650:Ros1	UTSW	10	52046209	missense	probably benign	0.00
R7667:Ros1	UTSW	10	52163971	missense	probably damaging	1.00
R7696:Ros1	UTSW	10	52142283	missense	probably damaging	1.00
R7785:Ros1	UTSW	10	52162848	missense	probably damaging	1.00
R7814:Ros1	UTSW	10	52096137	missense	probably benign	0.28
R7830:Ros1	UTSW	10	52154934	missense	probably damaging	0.99
R7832:Ros1	UTSW	10	52144861	missense	probably damaging	0.99
R7854:Ros1	UTSW	10	52128467	missense	probably damaging	1.00
R7912:Ros1	UTSW	10	52168695	missense	probably damaging	1.00
R7972:Ros1	UTSW	10	52154830	nonsense	probably null
R7993:Ros1	UTSW	10	52123347	missense	probably benign	0.34
R8036:Ros1	UTSW	10	52165343	missense	probably benign
R8137:Ros1	UTSW	10	52125837	missense	possibly damaging	0.87
R8169:Ros1	UTSW	10	52064672	critical splice donor site	probably null
R8199:Ros1	UTSW	10	52101717	nonsense	probably null
R8293:Ros1	UTSW	10	52087918	missense	probably damaging	1.00
R8368:Ros1	UTSW	10	52064737	missense	probably damaging	1.00
R8406:Ros1	UTSW	10	52101845	missense	possibly damaging	0.56
R8471:Ros1	UTSW	10	52120982	missense	probably benign	0.00
R8498:Ros1	UTSW	10	52178951	missense	probably damaging	0.99
R8532:Ros1	UTSW	10	52098756	missense	possibly damaging	0.92
RF018:Ros1	UTSW	10	52155121	missense	probably benign
Z1176:Ros1	UTSW	10	52091109	missense	possibly damaging	0.89
Z1177:Ros1	UTSW	10	52168671	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTACTTCGGTGTGAGAAAACAG -3'
(R):5'- CCAGACCTTTCCCATGCAATG -3'

Sequencing Primer
(F):5'- TCGGTGTGAGAAAACAGTATTTTATC -3'
(R):5'- TGGAACTCACTTTGTAGACCAGC -3'

Posted On

2014-06-23