Mutagenetix > Incidental Mutations

Incidental Mutation 'R1794:Ros1'

202060

Institutional Source

Beutler Lab

Gene Symbol

Ros1

Ensembl Gene

ENSMUSG00000019893

Gene Name

Ros1 proto-oncogene

Synonyms

Ros-1, c-ros

MMRRC Submission

039824-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R1794 (G1)

Quality Score

151

Status

Not validated

Chromosome

Chromosomal Location

52045721-52195244 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 52124103 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1109 (K1109*)

Ref Sequence

ENSEMBL: ENSMUSP00000151615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]

Predicted Effect

probably null
Transcript: ENSMUST00000020045
AA Change: K1130*

SMART Domains

Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: K1130*

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	568	654	2.24e-4	SMART
LY	734	776	2.28e1	SMART
LY	777	815	4.61e0	SMART
FN3	944	1023	5.53e-4	SMART
FN3	1037	1133	1.07e1	SMART
FN3	1440	1532	1.19e1	SMART
FN3	1551	1637	2.11e0	SMART
FN3	1649	1731	6.8e-4	SMART
FN3	1746	1832	2.7e1	SMART
TyrKc	1938	2208	1.3e-145	SMART
low complexity region	2294	2307	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117992
AA Change: K1109*

SMART Domains

Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: K1109*

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
TyrKc	1917	2187	1.3e-145	SMART
low complexity region	2273	2286	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000177378
AA Change: K1109*

SMART Domains

Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: K1109*

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
Blast:LY	1190	1236	2e-18	BLAST
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
transmembrane domain	1832	1854	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177387

Predicted Effect

probably null
Transcript: ENSMUST00000218452
AA Change: K1109*

Predicted Effect

probably null
Transcript: ENSMUST00000219173
AA Change: K1109*

Predicted Effect

probably benign
Transcript: ENSMUST00000219692

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,620	E44G	probably benign	Het
Anxa7	A	G	14: 20,471,467	Y54H	unknown	Het
Arhgef3	A	G	14: 27,397,605	T331A	probably benign	Het
Arhgef40	G	T	14: 51,989,930	C477F	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp13a5	C	A	16: 29,321,709	R343L	probably damaging	Het
Brdt	ACAGCAGCAGCAGCAGC	ACAGCAGCAGCAGC	5: 107,359,853		probably benign	Het
Btbd2	G	T	10: 80,643,913	D426E	probably damaging	Het
Cabin1	A	C	10: 75,725,745	I974R	possibly damaging	Het
Cacna1i	G	A	15: 80,389,122	V1670M	probably damaging	Het
Cc2d2a	C	A	5: 43,688,252	Q288K	probably damaging	Het
Ccl20	T	A	1: 83,117,829	I37K	possibly damaging	Het
Cdcp1	A	G	9: 123,190,094	V40A	probably benign	Het
Cdcp1	T	C	9: 123,215,831	T27A	probably benign	Het
Cdh4	C	T	2: 179,886,842	T581I	probably damaging	Het
Cgn	A	G	3: 94,762,557		probably null	Het
Col7a1	G	A	9: 108,965,928	G1493D	unknown	Het
Creb3	A	G	4: 43,563,302	E133G	probably benign	Het
Dchs1	T	C	7: 105,771,720	T498A	probably benign	Het
Dis3l	A	C	9: 64,317,776	V413G	possibly damaging	Het
Dnah6	T	C	6: 73,024,958	E3865G	probably damaging	Het
Fam219b	A	G	9: 57,539,281	Y139C	probably damaging	Het
Fat3	A	T	9: 15,997,136	Y2523*	probably null	Het
Fat3	A	T	9: 15,997,138	Y2523N	probably benign	Het
Fmnl1	T	C	11: 103,197,147	S40P	probably benign	Het
Gm17727	T	A	9: 35,777,122	I56F	probably benign	Het
Gm4792	T	C	10: 94,298,490	D6G	unknown	Het
Hhat	G	T	1: 192,693,906	Y306*	probably null	Het
Hmcn1	A	G	1: 150,598,285	I4802T	probably benign	Het
Hmcn1	G	A	1: 150,627,152	T3908I	probably damaging	Het
Hsph1	A	T	5: 149,630,773	N79K	probably damaging	Het
Ikbke	T	A	1: 131,259,218	Y579F	probably damaging	Het
Jak2	A	G	19: 29,299,557	D838G	probably benign	Het
Klhdc7b	T	C	15: 89,387,020	S702P	probably benign	Het
Lingo3	C	A	10: 80,835,598	R166L	probably benign	Het
Lins1	T	C	7: 66,711,909	F436S	probably damaging	Het
Lman1	T	C	18: 65,991,684	D328G	probably benign	Het
Lox	A	G	18: 52,528,307	C232R	probably damaging	Het
Lrrc59	T	C	11: 94,638,595	V165A	probably benign	Het
Map9	A	G	3: 82,380,221	D50G	probably damaging	Het
March1	T	A	8: 66,386,942	Y126N	possibly damaging	Het
Mcf2l	T	C	8: 12,915,982	F3L	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nin	G	A	12: 70,043,795	Q949*	probably null	Het
Nlgn3	A	G	X: 101,320,033	H636R	probably benign	Het
Notch2	A	G	3: 98,099,547	D411G	possibly damaging	Het
Olfr1263	A	G	2: 90,015,020	Y30C	probably damaging	Het
Olfr1449	G	C	19: 12,934,968	A77P	probably damaging	Het
Plekha7	A	G	7: 116,140,681	V579A	probably damaging	Het
Prrc2c	T	C	1: 162,705,959		probably benign	Het
Rab7b	T	C	1: 131,697,068		probably null	Het
Reg3b	G	T	6: 78,372,214		probably null	Het
Rgs20	A	G	1: 4,910,572	Y177H	probably damaging	Het
Ripk3	G	T	14: 55,785,329	N379K	probably benign	Het
Rnf220	G	T	4: 117,307,568	Q7K	probably benign	Het
Slc22a7	T	G	17: 46,433,153	R460S	probably damaging	Het
Slc4a2	A	G	5: 24,439,328	M975V	probably damaging	Het
Slc4a3	A	T	1: 75,557,308	I1100F	probably damaging	Het
Smco1	A	G	16: 32,274,132	E207G	probably benign	Het
Snrnp200	A	G	2: 127,216,736	E369G	probably benign	Het
Tcf4	T	A	18: 69,657,853	M178K	probably benign	Het
Tex2	T	C	11: 106,567,902		probably benign	Het
Tjp1	A	T	7: 65,323,129	I521N	probably damaging	Het
Tmem203	A	G	2: 25,255,994	T109A	probably benign	Het
Tmem50b	T	C	16: 91,578,029	I126V	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ush2a	T	C	1: 188,862,809	F3813L	probably benign	Het
Vmn1r203	C	T	13: 22,524,351	R101W	probably damaging	Het
Vmn2r79	G	A	7: 87,001,413	V136I	probably benign	Het
Wdr38	A	G	2: 39,000,729	Y205C	probably damaging	Het
Zfp248	A	G	6: 118,429,303	F442L	probably damaging	Het
Znrf4	A	G	17: 56,511,599	I236T	probably damaging	Het

Other mutations in Ros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ros1	APN	10	52194890	missense	probably benign	0.01
IGL00338:Ros1	APN	10	52125811	missense	probably benign
IGL00419:Ros1	APN	10	52091054	missense	probably damaging	0.97
IGL00840:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00841:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00951:Ros1	APN	10	52143252	missense	probably damaging	0.99
IGL01123:Ros1	APN	10	52120809	missense	probably damaging	1.00
IGL01128:Ros1	APN	10	52142328	nonsense	probably null
IGL01300:Ros1	APN	10	52101713	missense	probably benign	0.01
IGL01316:Ros1	APN	10	52087879	critical splice donor site	probably null
IGL01349:Ros1	APN	10	52051026	missense	probably damaging	0.99
IGL01363:Ros1	APN	10	52166142	missense	probably damaging	1.00
IGL01457:Ros1	APN	10	52046330	splice site	probably benign
IGL01532:Ros1	APN	10	52090938	splice site	probably benign
IGL01585:Ros1	APN	10	52155102	missense	probably damaging	1.00
IGL01650:Ros1	APN	10	52154979	missense	probably damaging	0.99
IGL01672:Ros1	APN	10	52101803	missense	possibly damaging	0.92
IGL01904:Ros1	APN	10	52077911	missense	probably damaging	0.97
IGL02040:Ros1	APN	10	52115922	missense	probably damaging	0.99
IGL02053:Ros1	APN	10	52162720	missense	probably damaging	1.00
IGL02147:Ros1	APN	10	52120895	missense	probably damaging	1.00
IGL02169:Ros1	APN	10	52081957	critical splice donor site	probably null
IGL02247:Ros1	APN	10	52129581	missense	probably damaging	0.99
IGL02262:Ros1	APN	10	52178969	missense	probably damaging	0.96
IGL02307:Ros1	APN	10	52128438	missense	possibly damaging	0.53
IGL02398:Ros1	APN	10	52144884	splice site	probably benign
IGL02525:Ros1	APN	10	52116042	missense	possibly damaging	0.66
IGL02718:Ros1	APN	10	52118232	missense	probably damaging	1.00
IGL02721:Ros1	APN	10	52172831	splice site	probably benign
IGL02808:Ros1	APN	10	52125889	missense	probably damaging	1.00
IGL03009:Ros1	APN	10	52145907	missense	probably benign	0.00
IGL03035:Ros1	APN	10	52075984	splice site	probably benign
IGL03092:Ros1	APN	10	52098806	missense	probably damaging	0.99
IGL03309:Ros1	APN	10	52118261	missense	possibly damaging	0.83
IGL03333:Ros1	APN	10	52155171	missense	probably damaging	1.00
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0125:Ros1	UTSW	10	52125789	missense	probably benign	0.38
R0403:Ros1	UTSW	10	52143438	splice site	probably benign
R0487:Ros1	UTSW	10	52155108	missense	possibly damaging	0.69
R0502:Ros1	UTSW	10	52194823	splice site	probably benign
R0557:Ros1	UTSW	10	52085263	missense	possibly damaging	0.82
R0599:Ros1	UTSW	10	52123300	missense	probably damaging	1.00
R0620:Ros1	UTSW	10	52118348	missense	probably damaging	1.00
R0679:Ros1	UTSW	10	52066295	missense	possibly damaging	0.95
R1005:Ros1	UTSW	10	52128405	splice site	probably benign
R1073:Ros1	UTSW	10	52046125	missense	probably damaging	1.00
R1220:Ros1	UTSW	10	52098870	missense	probably damaging	0.97
R1279:Ros1	UTSW	10	52142166	missense	possibly damaging	0.81
R1295:Ros1	UTSW	10	52087932	missense	possibly damaging	0.92
R1336:Ros1	UTSW	10	52168662	missense	probably damaging	1.00
R1371:Ros1	UTSW	10	52087945	missense	probably damaging	0.98
R1447:Ros1	UTSW	10	52098858	missense	possibly damaging	0.66
R1486:Ros1	UTSW	10	52172858	missense	probably damaging	1.00
R1499:Ros1	UTSW	10	52098677	missense	possibly damaging	0.92
R1669:Ros1	UTSW	10	52161811	missense	probably damaging	1.00
R1744:Ros1	UTSW	10	52123379	missense	probably damaging	0.99
R1759:Ros1	UTSW	10	52120826	missense	probably damaging	1.00
R1791:Ros1	UTSW	10	52100087	missense	probably benign	0.00
R2031:Ros1	UTSW	10	52067068	missense	possibly damaging	0.88
R2115:Ros1	UTSW	10	52128555	missense	probably benign	0.00
R2219:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R2290:Ros1	UTSW	10	52118381	missense	probably damaging	0.96
R2329:Ros1	UTSW	10	52162887	missense	probably damaging	1.00
R2371:Ros1	UTSW	10	52163895	missense	possibly damaging	0.66
R2879:Ros1	UTSW	10	52172840	critical splice donor site	probably null
R3154:Ros1	UTSW	10	52050981	missense	probably benign
R3423:Ros1	UTSW	10	52128416	unclassified	probably null
R3424:Ros1	UTSW	10	52128416	unclassified	probably null
R3425:Ros1	UTSW	10	52128416	unclassified	probably null
R3433:Ros1	UTSW	10	52091108	missense	probably benign	0.45
R3522:Ros1	UTSW	10	52090995	nonsense	probably null
R3686:Ros1	UTSW	10	52145816	missense	probably damaging	1.00
R3710:Ros1	UTSW	10	52161895	nonsense	probably null
R3771:Ros1	UTSW	10	52128991	missense	probably damaging	0.97
R3808:Ros1	UTSW	10	52120848	missense	probably benign	0.08
R3930:Ros1	UTSW	10	52194848	missense	possibly damaging	0.92
R3950:Ros1	UTSW	10	52066388	missense	probably damaging	1.00
R3981:Ros1	UTSW	10	52120878	missense	possibly damaging	0.46
R4007:Ros1	UTSW	10	52118232	missense	probably damaging	1.00
R4346:Ros1	UTSW	10	52168609	missense	possibly damaging	0.92
R4382:Ros1	UTSW	10	52120959	missense	possibly damaging	0.46
R4414:Ros1	UTSW	10	52162704	critical splice donor site	probably null
R4450:Ros1	UTSW	10	52077942	missense	probably damaging	0.98
R4468:Ros1	UTSW	10	52118356	missense	probably damaging	1.00
R4569:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R4649:Ros1	UTSW	10	52129668	missense	possibly damaging	0.66
R4684:Ros1	UTSW	10	52129096	missense	probably damaging	1.00
R4706:Ros1	UTSW	10	52101894	missense	possibly damaging	0.95
R4731:Ros1	UTSW	10	52142229	missense	probably damaging	1.00
R4748:Ros1	UTSW	10	52115997	missense	probably benign	0.00
R4806:Ros1	UTSW	10	52096175	missense	probably damaging	0.96
R4865:Ros1	UTSW	10	52172870	missense	probably damaging	0.99
R4973:Ros1	UTSW	10	52154991	missense	probably damaging	0.98
R5022:Ros1	UTSW	10	52124075	missense	possibly damaging	0.46
R5033:Ros1	UTSW	10	52128416	critical splice donor site	probably null
R5082:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5083:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5130:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5269:Ros1	UTSW	10	52051008	missense	probably damaging	1.00
R5399:Ros1	UTSW	10	52090944	critical splice donor site	probably null
R5414:Ros1	UTSW	10	52155093	missense	probably damaging	1.00
R5659:Ros1	UTSW	10	52143386	missense	possibly damaging	0.92
R5742:Ros1	UTSW	10	52142138	critical splice donor site	probably null
R5780:Ros1	UTSW	10	52194857	missense	probably damaging	1.00
R5805:Ros1	UTSW	10	52123289	missense	probably damaging	1.00
R5843:Ros1	UTSW	10	52166197	missense	possibly damaging	0.92
R5881:Ros1	UTSW	10	52181798	missense	probably benign	0.26
R6027:Ros1	UTSW	10	52163968	missense	possibly damaging	0.82
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6052:Ros1	UTSW	10	52163903	missense	probably benign	0.39
R6175:Ros1	UTSW	10	52101785	missense	probably benign	0.02
R6315:Ros1	UTSW	10	52118210	missense	probably benign
R6342:Ros1	UTSW	10	52155255	missense	probably damaging	1.00
R6470:Ros1	UTSW	10	52166044	critical splice donor site	probably null
R6527:Ros1	UTSW	10	52143377	missense	possibly damaging	0.66
R6568:Ros1	UTSW	10	52162812	missense	probably damaging	1.00
R6573:Ros1	UTSW	10	52155010	missense	possibly damaging	0.84
R6653:Ros1	UTSW	10	52142203	missense	probably damaging	1.00
R6959:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R7011:Ros1	UTSW	10	52180176	missense	probably damaging	1.00
R7111:Ros1	UTSW	10	52181810	missense	probably benign	0.02
R7243:Ros1	UTSW	10	52123381	missense	probably damaging	1.00
R7355:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R7385:Ros1	UTSW	10	52155126	missense	probably benign	0.00
R7460:Ros1	UTSW	10	52118203	missense	probably damaging	1.00
R7549:Ros1	UTSW	10	52145834	missense	probably damaging	0.96
R7573:Ros1	UTSW	10	52169976	missense	probably benign	0.03
R7650:Ros1	UTSW	10	52046209	missense	probably benign	0.00
R7667:Ros1	UTSW	10	52163971	missense	probably damaging	1.00
R7696:Ros1	UTSW	10	52142283	missense	probably damaging	1.00
R7785:Ros1	UTSW	10	52162848	missense	probably damaging	1.00
R7814:Ros1	UTSW	10	52096137	missense	probably benign	0.28
R7830:Ros1	UTSW	10	52154934	missense	probably damaging	0.99
R7832:Ros1	UTSW	10	52144861	missense	probably damaging	0.99
R7854:Ros1	UTSW	10	52128467	missense	probably damaging	1.00
R7912:Ros1	UTSW	10	52168695	missense	probably damaging	1.00
R7915:Ros1	UTSW	10	52144861	missense	probably damaging	0.99
R7937:Ros1	UTSW	10	52128467	missense	probably damaging	1.00
R7993:Ros1	UTSW	10	52168695	missense	probably damaging	1.00
RF018:Ros1	UTSW	10	52155121	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTACTTCGGTGTGAGAAAACAG -3'
(R):5'- CCAGACCTTTCCCATGCAATG -3'

Sequencing Primer
(F):5'- TCGGTGTGAGAAAACAGTATTTTATC -3'
(R):5'- TGGAACTCACTTTGTAGACCAGC -3'

Posted On

2014-06-23