Incidental Mutation 'R1794:Ripk3'
ID 202074
Institutional Source Beutler Lab
Gene Symbol Ripk3
Ensembl Gene ENSMUSG00000022221
Gene Name receptor-interacting serine-threonine kinase 3
Synonyms Rip3, 2610528K09Rik
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1794 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 55784995-55788865 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55785329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 379 (N379K)
Ref Sequence ENSEMBL: ENSMUSP00000137278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000022830] [ENSMUST00000168716] [ENSMUST00000170223] [ENSMUST00000178399] [ENSMUST00000227031] [ENSMUST00000228326] [ENSMUST00000228476]
AlphaFold Q9QZL0
Predicted Effect probably benign
Transcript: ENSMUST00000002398
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022830
AA Change: N443K

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022830
Gene: ENSMUSG00000022221
AA Change: N443K

DomainStartEndE-ValueType
Pfam:Pkinase 22 288 2.8e-38 PFAM
Pfam:Pkinase_Tyr 22 288 3e-34 PFAM
Pfam:RHIM 408 458 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168716
AA Change: N379K

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126306
Gene: ENSMUSG00000022221
AA Change: N379K

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170223
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178399
AA Change: N379K

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137278
Gene: ENSMUSG00000022221
AA Change: N379K

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226361
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228175
Predicted Effect probably benign
Transcript: ENSMUST00000228326
Predicted Effect probably benign
Transcript: ENSMUST00000228476
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alleles exhibit resistance to induced inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Ripk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Ripk3 APN 14 55786027 missense probably damaging 1.00
IGL02073:Ripk3 APN 14 55786025 critical splice donor site probably null
IGL02420:Ripk3 APN 14 55785234 missense probably benign 0.02
IGL03033:Ripk3 APN 14 55787165 unclassified probably benign
IGL03036:Ripk3 APN 14 55787339 missense probably benign 0.01
R0211:Ripk3 UTSW 14 55787918 missense probably damaging 1.00
R0352:Ripk3 UTSW 14 55786743 unclassified probably benign
R0366:Ripk3 UTSW 14 55786835 missense probably damaging 0.99
R0634:Ripk3 UTSW 14 55788391 unclassified probably benign
R1364:Ripk3 UTSW 14 55785260 splice site probably null
R1665:Ripk3 UTSW 14 55786351 missense probably benign 0.24
R1886:Ripk3 UTSW 14 55788237 critical splice donor site probably null
R2517:Ripk3 UTSW 14 55788035 missense probably damaging 0.97
R3409:Ripk3 UTSW 14 55788241 missense probably damaging 0.99
R3806:Ripk3 UTSW 14 55786268 missense probably benign 0.00
R5807:Ripk3 UTSW 14 55785298 missense probably damaging 1.00
R7138:Ripk3 UTSW 14 55788346 missense probably benign
R7278:Ripk3 UTSW 14 55787284 nonsense probably null
R8064:Ripk3 UTSW 14 55787926 missense possibly damaging 0.94
R9227:Ripk3 UTSW 14 55785846 missense probably benign 0.03
R9230:Ripk3 UTSW 14 55785846 missense probably benign 0.03
R9775:Ripk3 UTSW 14 55785795 missense unknown
Z1088:Ripk3 UTSW 14 55787926 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCAGGTTGCTTAAAACGTGC -3'
(R):5'- AGAGGCACAGCTCATACTGG -3'

Sequencing Primer
(F):5'- AAAACGTGCTTTTTATTGCCACGC -3'
(R):5'- CAGCTCATACTGGGACGCAGTAG -3'
Posted On 2014-06-23