Incidental Mutation 'R1794:Cacna1i'
ID 202076
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 039824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1794 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80273323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1670 (V1670M)
Ref Sequence ENSEMBL: ENSMUSP00000125229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably benign
Transcript: ENSMUST00000160175
SMART Domains Protein: ENSMUSP00000123881
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: V1670M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: V1670M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161863
SMART Domains Protein: ENSMUSP00000124367
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162025
SMART Domains Protein: ENSMUSP00000125530
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 87 103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162155
AA Change: V1670M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: V1670M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162913
SMART Domains Protein: ENSMUSP00000125617
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa7 A G 14: 20,521,535 (GRCm39) Y54H unknown Het
Arhgef3 A G 14: 27,119,562 (GRCm39) T331A probably benign Het
Arhgef40 G T 14: 52,227,387 (GRCm39) C477F possibly damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atp13a5 C A 16: 29,140,527 (GRCm39) R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,507,719 (GRCm39) probably benign Het
Btbd2 G T 10: 80,479,747 (GRCm39) D426E probably damaging Het
Cabin1 A C 10: 75,561,579 (GRCm39) I974R possibly damaging Het
Cc2d2a C A 5: 43,845,594 (GRCm39) Q288K probably damaging Het
Ccl20 T A 1: 83,095,550 (GRCm39) I37K possibly damaging Het
Cdcp1 A G 9: 123,019,159 (GRCm39) V40A probably benign Het
Cdcp1 T C 9: 123,044,896 (GRCm39) T27A probably benign Het
Cdh4 C T 2: 179,528,635 (GRCm39) T581I probably damaging Het
Cgn A G 3: 94,669,864 (GRCm39) probably null Het
Col7a1 G A 9: 108,794,996 (GRCm39) G1493D unknown Het
Creb3 A G 4: 43,563,302 (GRCm39) E133G probably benign Het
Dchs1 T C 7: 105,420,927 (GRCm39) T498A probably benign Het
Dis3l A C 9: 64,225,058 (GRCm39) V413G possibly damaging Het
Dnah6 T C 6: 73,001,941 (GRCm39) E3865G probably damaging Het
Fam219b A G 9: 57,446,564 (GRCm39) Y139C probably damaging Het
Fat3 A T 9: 15,908,432 (GRCm39) Y2523* probably null Het
Fat3 A T 9: 15,908,434 (GRCm39) Y2523N probably benign Het
Fmnl1 T C 11: 103,087,973 (GRCm39) S40P probably benign Het
Gm4792 T C 10: 94,134,352 (GRCm39) D6G unknown Het
Hhat G T 1: 192,376,214 (GRCm39) Y306* probably null Het
Hmcn1 A G 1: 150,474,036 (GRCm39) I4802T probably benign Het
Hmcn1 G A 1: 150,502,903 (GRCm39) T3908I probably damaging Het
Hsph1 A T 5: 149,554,238 (GRCm39) N79K probably damaging Het
Ikbke T A 1: 131,186,955 (GRCm39) Y579F probably damaging Het
Jak2 A G 19: 29,276,957 (GRCm39) D838G probably benign Het
Klhdc7b T C 15: 89,271,223 (GRCm39) S702P probably benign Het
Lingo3 C A 10: 80,671,432 (GRCm39) R166L probably benign Het
Lins1 T C 7: 66,361,657 (GRCm39) F436S probably damaging Het
Lman1 T C 18: 66,124,755 (GRCm39) D328G probably benign Het
Lox A G 18: 52,661,379 (GRCm39) C232R probably damaging Het
Lrrc59 T C 11: 94,529,421 (GRCm39) V165A probably benign Het
Map9 A G 3: 82,287,528 (GRCm39) D50G probably damaging Het
Marchf1 T A 8: 66,839,594 (GRCm39) Y126N possibly damaging Het
Mcf2l T C 8: 12,965,982 (GRCm39) F3L probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Nin G A 12: 70,090,569 (GRCm39) Q949* probably null Het
Nlgn3 A G X: 100,363,639 (GRCm39) H636R probably benign Het
Notch2 A G 3: 98,006,863 (GRCm39) D411G possibly damaging Het
Or4c52 A G 2: 89,845,364 (GRCm39) Y30C probably damaging Het
Or5b24 G C 19: 12,912,332 (GRCm39) A77P probably damaging Het
Pate7 T A 9: 35,688,418 (GRCm39) I56F probably benign Het
Plekha7 A G 7: 115,739,916 (GRCm39) V579A probably damaging Het
Prrc2c T C 1: 162,533,528 (GRCm39) probably benign Het
Rab7b T C 1: 131,624,806 (GRCm39) probably null Het
Reg3b G T 6: 78,349,197 (GRCm39) probably null Het
Rgs20 A G 1: 4,980,795 (GRCm39) Y177H probably damaging Het
Ripk3 G T 14: 56,022,786 (GRCm39) N379K probably benign Het
Rnf220 G T 4: 117,164,765 (GRCm39) Q7K probably benign Het
Ros1 T A 10: 52,000,199 (GRCm39) K1109* probably null Het
Slc22a7 T G 17: 46,744,079 (GRCm39) R460S probably damaging Het
Slc4a2 A G 5: 24,644,326 (GRCm39) M975V probably damaging Het
Slc4a3 A T 1: 75,533,952 (GRCm39) I1100F probably damaging Het
Smco1 A G 16: 32,092,950 (GRCm39) E207G probably benign Het
Snrnp200 A G 2: 127,058,656 (GRCm39) E369G probably benign Het
Spata31d1e T C 13: 59,890,434 (GRCm39) E44G probably benign Het
Tcf4 T A 18: 69,790,924 (GRCm39) M178K probably benign Het
Tex2 T C 11: 106,458,728 (GRCm39) probably benign Het
Tjp1 A T 7: 64,972,877 (GRCm39) I521N probably damaging Het
Tmem203 A G 2: 25,146,006 (GRCm39) T109A probably benign Het
Tmem50b T C 16: 91,374,917 (GRCm39) I126V probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ush2a T C 1: 188,595,006 (GRCm39) F3813L probably benign Het
Vmn1r203 C T 13: 22,708,521 (GRCm39) R101W probably damaging Het
Vmn2r79 G A 7: 86,650,621 (GRCm39) V136I probably benign Het
Wdr38 A G 2: 38,890,741 (GRCm39) Y205C probably damaging Het
Zfp248 A G 6: 118,406,264 (GRCm39) F442L probably damaging Het
Znrf4 A G 17: 56,818,599 (GRCm39) I236T probably damaging Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GACCTCTGGTAGCCTTTTGC -3'
(R):5'- ATCGCCCTCTCTTGAAGCTG -3'

Sequencing Primer
(F):5'- TGCGCCCTCTGTACTAGG -3'
(R):5'- CTCTCTTGAAGCTGAACACAGAGG -3'
Posted On 2014-06-23