Incidental Mutation 'R1795:Pikfyve'
ID202094
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Namephosphoinositide kinase, FYVE type zinc finger containing
SynonymsPip5k3
MMRRC Submission 039825-MU
Accession Numbers

Genbank: NM_011086

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1795 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location65186683-65278695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65252557 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1312 (Y1312H)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1267H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1267H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: Y1312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1312H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,682,989 G1037* probably null Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Abcg5 A G 17: 84,673,579 I194T probably damaging Het
Abtb2 A G 2: 103,567,024 T100A probably benign Het
Adam4 C T 12: 81,421,294 M184I probably benign Het
Afap1l2 T C 19: 56,928,409 D155G probably damaging Het
Ahnak T C 19: 9,002,438 V362A possibly damaging Het
Ak7 C T 12: 105,726,223 R179* probably null Het
Akap8 C A 17: 32,315,477 G332C probably damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Ankrd12 T C 17: 65,986,227 E737G possibly damaging Het
Atrn A G 2: 130,972,288 D718G probably benign Het
Bco2 A G 9: 50,541,169 S200P possibly damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdc14a T A 3: 116,298,473 Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Celsr1 A T 15: 86,030,323 S1150T probably damaging Het
Cntfr A G 4: 41,670,841 probably null Het
Cramp1l T C 17: 24,964,910 N1244D probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Cyp4f17 A T 17: 32,517,969 I92F probably benign Het
Dhx30 A T 9: 110,107,983 probably null Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dmgdh A T 13: 93,706,699 M348L probably benign Het
Dnmt3b G A 2: 153,683,639 E741K possibly damaging Het
Dock3 T G 9: 107,025,335 H292P probably damaging Het
Elmsan1 A G 12: 84,158,974 probably null Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Etl4 T C 2: 20,808,026 probably null Het
Exoc7 A T 11: 116,292,521 I498N probably damaging Het
Fap G A 2: 62,548,589 S123L probably damaging Het
Foxn1 T C 11: 78,371,225 E106G probably benign Het
Fscb T A 12: 64,474,401 D97V probably damaging Het
Gabrg1 T C 5: 70,782,253 T174A possibly damaging Het
Gan C T 8: 117,196,460 A461V possibly damaging Het
Gbp2 T A 3: 142,630,523 D211E possibly damaging Het
Gm10271 A T 10: 116,956,841 Y47N unknown Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm1758 T A 16: 14,502,278 noncoding transcript Het
Golga3 A G 5: 110,207,627 K989R possibly damaging Het
Gucy2g C A 19: 55,199,541 V1041F probably damaging Het
Guk1 A T 11: 59,186,813 F25I probably benign Het
H2al1o C T X: 9,572,090 E87K possibly damaging Het
Hemgn C A 4: 46,395,958 C426F probably damaging Het
Hps3 A G 3: 20,012,695 probably null Het
Il2rb A T 15: 78,483,987 D287E probably damaging Het
Ino80 A T 2: 119,406,859 V1123D probably damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif21a A T 15: 90,972,727 probably null Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Krt2 A G 15: 101,816,426 F250L possibly damaging Het
Krt82 T A 15: 101,543,384 N332I possibly damaging Het
Lgi1 A G 19: 38,306,183 I444V probably benign Het
Lmod1 G A 1: 135,325,124 V39M probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Mlxipl A C 5: 135,107,170 D83A probably damaging Het
Mroh8 T A 2: 157,269,551 E161V probably benign Het
Mroh9 G A 1: 163,056,778 T397I probably damaging Het
Mtss1 T C 15: 59,058,400 D32G possibly damaging Het
Mus81 T C 19: 5,483,476 D495G probably benign Het
Neurod1 A C 2: 79,454,329 S237A probably benign Het
Npas1 G A 7: 16,474,800 R51C probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
P2ry14 T C 3: 59,115,853 N62S probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcdhb14 A T 18: 37,449,535 M565L probably benign Het
Pde6a A G 18: 61,257,212 E502G probably damaging Het
Pde8b A G 13: 95,042,019 V566A probably benign Het
Phf11b G T 14: 59,328,105 Q108K probably benign Het
Plcb3 T C 19: 6,956,013 probably benign Het
Plxna2 G A 1: 194,806,303 G1629D probably damaging Het
Plxnb1 T C 9: 109,100,745 V223A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Prl2a1 A T 13: 27,808,571 N226I probably damaging Het
Pus7 A C 5: 23,741,916 M636R probably damaging Het
Samd9l G A 6: 3,375,264 Q666* probably null Het
Sema3d A G 5: 12,584,887 D640G probably benign Het
Slc6a15 A G 10: 103,400,260 I279V probably benign Het
Slk T C 19: 47,620,534 V642A possibly damaging Het
Spta1 T A 1: 174,245,730 M2305K probably damaging Het
Srrt T C 5: 137,303,012 probably benign Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Tap1 T C 17: 34,194,925 L638P probably benign Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tecta T C 9: 42,378,049 T407A probably benign Het
Tmbim7 T C 5: 3,657,493 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ugt2a2 A G 5: 87,474,456 S428P probably benign Het
Vmn1r189 T C 13: 22,102,154 E171G probably benign Het
Vmn1r61 T C 7: 5,611,325 probably benign Het
Vmn2r120 A T 17: 57,525,038 S250R probably benign Het
Vmn2r8 T C 5: 108,803,106 R158G probably benign Het
Vmn2r98 A T 17: 19,066,440 Y400F probably damaging Het
Vps13c C A 9: 67,893,985 Y582* probably null Het
Zfp518a T A 19: 40,915,556 F1310I probably benign Het
Zswim1 A G 2: 164,825,400 I191V probably benign Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGATCACTCGTTACTTG -3'
(R):5'- AAACACAGAAAGGATTGTCTGC -3'

Sequencing Primer
(F):5'- CACTCGTTACTTGCTGTGTGGAC -3'
(R):5'- CAGAAAGGATTGTCTGCTAAATTAAC -3'
Posted On2014-06-23