Incidental Mutation 'R1795:Pikfyve'
ID 202094
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 039825-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1795 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65291716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1312 (Y1312H)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1267H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1267H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: Y1312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1312H

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,941,792 (GRCm39) I1159T probably benign Het
Abcc1 T C 16: 14,283,001 (GRCm39) V1159A possibly damaging Het
Abcg5 A G 17: 84,981,007 (GRCm39) I194T probably damaging Het
Abtb2 A G 2: 103,397,369 (GRCm39) T100A probably benign Het
Adam4 C T 12: 81,468,068 (GRCm39) M184I probably benign Het
Afap1l2 T C 19: 56,916,841 (GRCm39) D155G probably damaging Het
Ahnak T C 19: 8,979,802 (GRCm39) V362A possibly damaging Het
Ak7 C T 12: 105,692,482 (GRCm39) R179* probably null Het
Akap8 C A 17: 32,534,451 (GRCm39) G332C probably damaging Het
Akr1e1 T A 13: 4,645,071 (GRCm39) Q204L probably damaging Het
Ankrd12 T C 17: 66,293,222 (GRCm39) E737G possibly damaging Het
Atrn A G 2: 130,814,208 (GRCm39) D718G probably benign Het
Bco2 A G 9: 50,452,469 (GRCm39) S200P possibly damaging Het
C030005K15Rik A T 10: 97,561,648 (GRCm39) S28T unknown Het
Cdc14a T A 3: 116,092,122 (GRCm39) Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,799,654 (GRCm39) L387P probably damaging Het
Celsr1 A T 15: 85,914,524 (GRCm39) S1150T probably damaging Het
Cntfr A G 4: 41,670,841 (GRCm39) probably null Het
Cramp1 T C 17: 25,183,884 (GRCm39) N1244D probably damaging Het
Csmd3 G T 15: 47,721,316 (GRCm39) D1542E possibly damaging Het
Cyp4f17 A T 17: 32,736,943 (GRCm39) I92F probably benign Het
Dhx30 A T 9: 109,937,051 (GRCm39) probably null Het
Dlg1 T A 16: 31,561,965 (GRCm39) H120Q probably benign Het
Dmgdh A T 13: 93,843,207 (GRCm39) M348L probably benign Het
Dnmt3b G A 2: 153,525,559 (GRCm39) E741K possibly damaging Het
Dock3 T G 9: 106,902,534 (GRCm39) H292P probably damaging Het
Ercc6 T A 14: 32,238,985 (GRCm39) N24K probably benign Het
Esco2 T C 14: 66,064,726 (GRCm39) Q338R probably benign Het
Etl4 T C 2: 20,812,837 (GRCm39) probably null Het
Exoc7 A T 11: 116,183,347 (GRCm39) I498N probably damaging Het
Fap G A 2: 62,378,933 (GRCm39) S123L probably damaging Het
Foxn1 T C 11: 78,262,051 (GRCm39) E106G probably benign Het
Fscb T A 12: 64,521,175 (GRCm39) D97V probably damaging Het
Gabrg1 T C 5: 70,939,596 (GRCm39) T174A possibly damaging Het
Gan C T 8: 117,923,199 (GRCm39) A461V possibly damaging Het
Gbp2 T A 3: 142,336,284 (GRCm39) D211E possibly damaging Het
Gm10271 A T 10: 116,792,746 (GRCm39) Y47N unknown Het
Gm17333 G T 16: 77,649,711 (GRCm39) noncoding transcript Het
Gm1758 T A 16: 14,320,142 (GRCm39) noncoding transcript Het
Golga3 A G 5: 110,355,493 (GRCm39) K989R possibly damaging Het
Gucy2g C A 19: 55,187,973 (GRCm39) V1041F probably damaging Het
Guk1 A T 11: 59,077,639 (GRCm39) F25I probably benign Het
H2al1o C T X: 9,438,329 (GRCm39) E87K possibly damaging Het
Hemgn C A 4: 46,395,958 (GRCm39) C426F probably damaging Het
Hps3 A G 3: 20,066,859 (GRCm39) probably null Het
Il2rb A T 15: 78,368,187 (GRCm39) D287E probably damaging Het
Ino80 A T 2: 119,237,340 (GRCm39) V1123D probably damaging Het
Kdm2b A G 5: 123,122,523 (GRCm39) probably null Het
Kif21a A T 15: 90,856,930 (GRCm39) probably null Het
Klhl33 A T 14: 51,129,583 (GRCm39) N347K probably damaging Het
Krt1c A G 15: 101,724,861 (GRCm39) F250L possibly damaging Het
Krt82 T A 15: 101,451,819 (GRCm39) N332I possibly damaging Het
Lgi1 A G 19: 38,294,631 (GRCm39) I444V probably benign Het
Lmod1 G A 1: 135,252,862 (GRCm39) V39M probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mex3d T C 10: 80,217,376 (GRCm39) T149A probably benign Het
Mideas A G 12: 84,205,748 (GRCm39) probably null Het
Mlxipl A C 5: 135,136,024 (GRCm39) D83A probably damaging Het
Mroh8 T A 2: 157,111,471 (GRCm39) E161V probably benign Het
Mroh9 G A 1: 162,884,347 (GRCm39) T397I probably damaging Het
Mtss1 T C 15: 58,930,249 (GRCm39) D32G possibly damaging Het
Mus81 T C 19: 5,533,504 (GRCm39) D495G probably benign Het
Neurod1 A C 2: 79,284,673 (GRCm39) S237A probably benign Het
Npas1 G A 7: 16,208,725 (GRCm39) R51C probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
P2ry14 T C 3: 59,023,274 (GRCm39) N62S probably damaging Het
Pcdh15 A G 10: 74,460,087 (GRCm39) Y1308C probably damaging Het
Pcdhb14 A T 18: 37,582,588 (GRCm39) M565L probably benign Het
Pde6a A G 18: 61,390,283 (GRCm39) E502G probably damaging Het
Pde8b A G 13: 95,178,527 (GRCm39) V566A probably benign Het
Phf11b G T 14: 59,565,554 (GRCm39) Q108K probably benign Het
Plcb3 T C 19: 6,933,381 (GRCm39) probably benign Het
Plxna2 G A 1: 194,488,611 (GRCm39) G1629D probably damaging Het
Plxnb1 T C 9: 108,929,813 (GRCm39) V223A probably benign Het
Prkca A T 11: 107,903,518 (GRCm39) Y285N possibly damaging Het
Prl2a1 A T 13: 27,992,554 (GRCm39) N226I probably damaging Het
Pus7 A C 5: 23,946,914 (GRCm39) M636R probably damaging Het
Samd9l G A 6: 3,375,264 (GRCm39) Q666* probably null Het
Sema3d A G 5: 12,634,854 (GRCm39) D640G probably benign Het
Slc6a15 A G 10: 103,236,121 (GRCm39) I279V probably benign Het
Slk T C 19: 47,608,973 (GRCm39) V642A possibly damaging Het
Spata31e2 C A 1: 26,722,070 (GRCm39) G1037* probably null Het
Spta1 T A 1: 174,073,296 (GRCm39) M2305K probably damaging Het
Srrt T C 5: 137,301,274 (GRCm39) probably benign Het
Stfa2l1 A T 16: 35,977,228 (GRCm39) I8L probably benign Het
Tap1 T C 17: 34,413,899 (GRCm39) L638P probably benign Het
Tbccd1 A T 16: 22,640,995 (GRCm39) L461M probably benign Het
Tecta T C 9: 42,289,345 (GRCm39) T407A probably benign Het
Tmbim7 T C 5: 3,707,493 (GRCm39) probably null Het
Tnrc18 C A 5: 142,800,869 (GRCm39) V30L probably benign Het
Tomm7 A G 5: 24,049,025 (GRCm39) F16S probably damaging Het
Ugt2a2 A G 5: 87,622,315 (GRCm39) S428P probably benign Het
Vmn1r189 T C 13: 22,286,324 (GRCm39) E171G probably benign Het
Vmn1r61 T C 7: 5,614,324 (GRCm39) probably benign Het
Vmn2r120 A T 17: 57,832,038 (GRCm39) S250R probably benign Het
Vmn2r8 T C 5: 108,950,972 (GRCm39) R158G probably benign Het
Vmn2r98 A T 17: 19,286,702 (GRCm39) Y400F probably damaging Het
Vps13c C A 9: 67,801,267 (GRCm39) Y582* probably null Het
Zfp518a T A 19: 40,904,000 (GRCm39) F1310I probably benign Het
Zswim1 A G 2: 164,667,320 (GRCm39) I191V probably benign Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGATCACTCGTTACTTG -3'
(R):5'- AAACACAGAAAGGATTGTCTGC -3'

Sequencing Primer
(F):5'- CACTCGTTACTTGCTGTGTGGAC -3'
(R):5'- CAGAAAGGATTGTCTGCTAAATTAAC -3'
Posted On 2014-06-23