Mutagenetix > Incidental Mutation

Incidental Mutation 'R1795:Pikfyve'

202094

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

039825-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1795 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65252557 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1312 (Y1312H)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: Y1267H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y1267H

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: Y1312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y1312H

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,682,989	G1037*	probably null	Het
Abca8a	A	G	11: 110,050,966	I1159T	probably benign	Het
Abcc1	T	C	16: 14,465,137	V1159A	possibly damaging	Het
Abcg5	A	G	17: 84,673,579	I194T	probably damaging	Het
Abtb2	A	G	2: 103,567,024	T100A	probably benign	Het
Adam4	C	T	12: 81,421,294	M184I	probably benign	Het
Afap1l2	T	C	19: 56,928,409	D155G	probably damaging	Het
Ahnak	T	C	19: 9,002,438	V362A	possibly damaging	Het
Ak7	C	T	12: 105,726,223	R179*	probably null	Het
Akap8	C	A	17: 32,315,477	G332C	probably damaging	Het
Akr1e1	T	A	13: 4,595,072	Q204L	probably damaging	Het
Ankrd12	T	C	17: 65,986,227	E737G	possibly damaging	Het
Atrn	A	G	2: 130,972,288	D718G	probably benign	Het
Bco2	A	G	9: 50,541,169	S200P	possibly damaging	Het
C030005K15Rik	A	T	10: 97,725,786	S28T	unknown	Het
Cdc14a	T	A	3: 116,298,473	Q356L	possibly damaging	Het
Cdk5rap3	A	G	11: 96,908,828	L387P	probably damaging	Het
Celsr1	A	T	15: 86,030,323	S1150T	probably damaging	Het
Cntfr	A	G	4: 41,670,841		probably null	Het
Cramp1l	T	C	17: 24,964,910	N1244D	probably damaging	Het
Csmd3	G	T	15: 47,857,920	D1542E	possibly damaging	Het
Cyp4f17	A	T	17: 32,517,969	I92F	probably benign	Het
Dhx30	A	T	9: 110,107,983		probably null	Het
Dlg1	T	A	16: 31,743,147	H120Q	probably benign	Het
Dmgdh	A	T	13: 93,706,699	M348L	probably benign	Het
Dnmt3b	G	A	2: 153,683,639	E741K	possibly damaging	Het
Dock3	T	G	9: 107,025,335	H292P	probably damaging	Het
Elmsan1	A	G	12: 84,158,974		probably null	Het
Ercc6	T	A	14: 32,517,028	N24K	probably benign	Het
Esco2	T	C	14: 65,827,277	Q338R	probably benign	Het
Etl4	T	C	2: 20,808,026		probably null	Het
Exoc7	A	T	11: 116,292,521	I498N	probably damaging	Het
Fap	G	A	2: 62,548,589	S123L	probably damaging	Het
Foxn1	T	C	11: 78,371,225	E106G	probably benign	Het
Fscb	T	A	12: 64,474,401	D97V	probably damaging	Het
Gabrg1	T	C	5: 70,782,253	T174A	possibly damaging	Het
Gan	C	T	8: 117,196,460	A461V	possibly damaging	Het
Gbp2	T	A	3: 142,630,523	D211E	possibly damaging	Het
Gm10271	A	T	10: 116,956,841	Y47N	unknown	Het
Gm17333	G	T	16: 77,852,823		noncoding transcript	Het
Gm1758	T	A	16: 14,502,278		noncoding transcript	Het
Golga3	A	G	5: 110,207,627	K989R	possibly damaging	Het
Gucy2g	C	A	19: 55,199,541	V1041F	probably damaging	Het
Guk1	A	T	11: 59,186,813	F25I	probably benign	Het
H2al1o	C	T	X: 9,572,090	E87K	possibly damaging	Het
Hemgn	C	A	4: 46,395,958	C426F	probably damaging	Het
Hps3	A	G	3: 20,012,695		probably null	Het
Il2rb	A	T	15: 78,483,987	D287E	probably damaging	Het
Ino80	A	T	2: 119,406,859	V1123D	probably damaging	Het
Kdm2b	A	G	5: 122,984,460		probably null	Het
Kif21a	A	T	15: 90,972,727		probably null	Het
Klhl33	A	T	14: 50,892,126	N347K	probably damaging	Het
Krt2	A	G	15: 101,816,426	F250L	possibly damaging	Het
Krt82	T	A	15: 101,543,384	N332I	possibly damaging	Het
Lgi1	A	G	19: 38,306,183	I444V	probably benign	Het
Lmod1	G	A	1: 135,325,124	V39M	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mex3d	T	C	10: 80,381,542	T149A	probably benign	Het
Mlxipl	A	C	5: 135,107,170	D83A	probably damaging	Het
Mroh8	T	A	2: 157,269,551	E161V	probably benign	Het
Mroh9	G	A	1: 163,056,778	T397I	probably damaging	Het
Mtss1	T	C	15: 59,058,400	D32G	possibly damaging	Het
Mus81	T	C	19: 5,483,476	D495G	probably benign	Het
Neurod1	A	C	2: 79,454,329	S237A	probably benign	Het
Npas1	G	A	7: 16,474,800	R51C	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
P2ry14	T	C	3: 59,115,853	N62S	probably damaging	Het
Pcdh15	A	G	10: 74,624,255	Y1308C	probably damaging	Het
Pcdhb14	A	T	18: 37,449,535	M565L	probably benign	Het
Pde6a	A	G	18: 61,257,212	E502G	probably damaging	Het
Pde8b	A	G	13: 95,042,019	V566A	probably benign	Het
Phf11b	G	T	14: 59,328,105	Q108K	probably benign	Het
Plcb3	T	C	19: 6,956,013		probably benign	Het
Plxna2	G	A	1: 194,806,303	G1629D	probably damaging	Het
Plxnb1	T	C	9: 109,100,745	V223A	probably benign	Het
Prkca	A	T	11: 108,012,692	Y285N	possibly damaging	Het
Prl2a1	A	T	13: 27,808,571	N226I	probably damaging	Het
Pus7	A	C	5: 23,741,916	M636R	probably damaging	Het
Samd9l	G	A	6: 3,375,264	Q666*	probably null	Het
Sema3d	A	G	5: 12,584,887	D640G	probably benign	Het
Slc6a15	A	G	10: 103,400,260	I279V	probably benign	Het
Slk	T	C	19: 47,620,534	V642A	possibly damaging	Het
Spta1	T	A	1: 174,245,730	M2305K	probably damaging	Het
Srrt	T	C	5: 137,303,012		probably benign	Het
Stfa2l1	A	T	16: 36,156,858	I8L	probably benign	Het
Tap1	T	C	17: 34,194,925	L638P	probably benign	Het
Tbccd1	A	T	16: 22,822,245	L461M	probably benign	Het
Tecta	T	C	9: 42,378,049	T407A	probably benign	Het
Tmbim7	T	C	5: 3,657,493		probably null	Het
Tnrc18	C	A	5: 142,815,114	V30L	probably benign	Het
Tomm7	A	G	5: 23,844,027	F16S	probably damaging	Het
Ugt2a2	A	G	5: 87,474,456	S428P	probably benign	Het
Vmn1r189	T	C	13: 22,102,154	E171G	probably benign	Het
Vmn1r61	T	C	7: 5,611,325		probably benign	Het
Vmn2r120	A	T	17: 57,525,038	S250R	probably benign	Het
Vmn2r8	T	C	5: 108,803,106	R158G	probably benign	Het
Vmn2r98	A	T	17: 19,066,440	Y400F	probably damaging	Het
Vps13c	C	A	9: 67,893,985	Y582*	probably null	Het
Zfp518a	T	A	19: 40,915,556	F1310I	probably benign	Het
Zswim1	A	G	2: 164,825,400	I191V	probably benign	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTGATCACTCGTTACTTG -3'
(R):5'- AAACACAGAAAGGATTGTCTGC -3'

Sequencing Primer
(F):5'- CACTCGTTACTTGCTGTGTGGAC -3'
(R):5'- CAGAAAGGATTGTCTGCTAAATTAAC -3'

Posted On

2014-06-23