Incidental Mutation 'R1795:Spta1'
ID 202097
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Name spectrin alpha, erythrocytic 1
Synonyms erythroid, Spna-1, ihj, Spna1
MMRRC Submission 039825-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.854) question?
Stock # R1795 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 174000342-174076016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 174073296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 2305 (M2305K)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]
AlphaFold P08032
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: M2305K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: M2305K

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061990
SMART Domains Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-53 PFAM
Pfam:7tm_1 41 290 3.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Predicted Effect probably benign
Transcript: ENSMUST00000214725
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,941,792 (GRCm39) I1159T probably benign Het
Abcc1 T C 16: 14,283,001 (GRCm39) V1159A possibly damaging Het
Abcg5 A G 17: 84,981,007 (GRCm39) I194T probably damaging Het
Abtb2 A G 2: 103,397,369 (GRCm39) T100A probably benign Het
Adam4 C T 12: 81,468,068 (GRCm39) M184I probably benign Het
Afap1l2 T C 19: 56,916,841 (GRCm39) D155G probably damaging Het
Ahnak T C 19: 8,979,802 (GRCm39) V362A possibly damaging Het
Ak7 C T 12: 105,692,482 (GRCm39) R179* probably null Het
Akap8 C A 17: 32,534,451 (GRCm39) G332C probably damaging Het
Akr1e1 T A 13: 4,645,071 (GRCm39) Q204L probably damaging Het
Ankrd12 T C 17: 66,293,222 (GRCm39) E737G possibly damaging Het
Atrn A G 2: 130,814,208 (GRCm39) D718G probably benign Het
Bco2 A G 9: 50,452,469 (GRCm39) S200P possibly damaging Het
C030005K15Rik A T 10: 97,561,648 (GRCm39) S28T unknown Het
Cdc14a T A 3: 116,092,122 (GRCm39) Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,799,654 (GRCm39) L387P probably damaging Het
Celsr1 A T 15: 85,914,524 (GRCm39) S1150T probably damaging Het
Cntfr A G 4: 41,670,841 (GRCm39) probably null Het
Cramp1 T C 17: 25,183,884 (GRCm39) N1244D probably damaging Het
Csmd3 G T 15: 47,721,316 (GRCm39) D1542E possibly damaging Het
Cyp4f17 A T 17: 32,736,943 (GRCm39) I92F probably benign Het
Dhx30 A T 9: 109,937,051 (GRCm39) probably null Het
Dlg1 T A 16: 31,561,965 (GRCm39) H120Q probably benign Het
Dmgdh A T 13: 93,843,207 (GRCm39) M348L probably benign Het
Dnmt3b G A 2: 153,525,559 (GRCm39) E741K possibly damaging Het
Dock3 T G 9: 106,902,534 (GRCm39) H292P probably damaging Het
Ercc6 T A 14: 32,238,985 (GRCm39) N24K probably benign Het
Esco2 T C 14: 66,064,726 (GRCm39) Q338R probably benign Het
Etl4 T C 2: 20,812,837 (GRCm39) probably null Het
Exoc7 A T 11: 116,183,347 (GRCm39) I498N probably damaging Het
Fap G A 2: 62,378,933 (GRCm39) S123L probably damaging Het
Foxn1 T C 11: 78,262,051 (GRCm39) E106G probably benign Het
Fscb T A 12: 64,521,175 (GRCm39) D97V probably damaging Het
Gabrg1 T C 5: 70,939,596 (GRCm39) T174A possibly damaging Het
Gan C T 8: 117,923,199 (GRCm39) A461V possibly damaging Het
Gbp2 T A 3: 142,336,284 (GRCm39) D211E possibly damaging Het
Gm10271 A T 10: 116,792,746 (GRCm39) Y47N unknown Het
Gm17333 G T 16: 77,649,711 (GRCm39) noncoding transcript Het
Gm1758 T A 16: 14,320,142 (GRCm39) noncoding transcript Het
Golga3 A G 5: 110,355,493 (GRCm39) K989R possibly damaging Het
Gucy2g C A 19: 55,187,973 (GRCm39) V1041F probably damaging Het
Guk1 A T 11: 59,077,639 (GRCm39) F25I probably benign Het
H2al1o C T X: 9,438,329 (GRCm39) E87K possibly damaging Het
Hemgn C A 4: 46,395,958 (GRCm39) C426F probably damaging Het
Hps3 A G 3: 20,066,859 (GRCm39) probably null Het
Il2rb A T 15: 78,368,187 (GRCm39) D287E probably damaging Het
Ino80 A T 2: 119,237,340 (GRCm39) V1123D probably damaging Het
Kdm2b A G 5: 123,122,523 (GRCm39) probably null Het
Kif21a A T 15: 90,856,930 (GRCm39) probably null Het
Klhl33 A T 14: 51,129,583 (GRCm39) N347K probably damaging Het
Krt1c A G 15: 101,724,861 (GRCm39) F250L possibly damaging Het
Krt82 T A 15: 101,451,819 (GRCm39) N332I possibly damaging Het
Lgi1 A G 19: 38,294,631 (GRCm39) I444V probably benign Het
Lmod1 G A 1: 135,252,862 (GRCm39) V39M probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mex3d T C 10: 80,217,376 (GRCm39) T149A probably benign Het
Mideas A G 12: 84,205,748 (GRCm39) probably null Het
Mlxipl A C 5: 135,136,024 (GRCm39) D83A probably damaging Het
Mroh8 T A 2: 157,111,471 (GRCm39) E161V probably benign Het
Mroh9 G A 1: 162,884,347 (GRCm39) T397I probably damaging Het
Mtss1 T C 15: 58,930,249 (GRCm39) D32G possibly damaging Het
Mus81 T C 19: 5,533,504 (GRCm39) D495G probably benign Het
Neurod1 A C 2: 79,284,673 (GRCm39) S237A probably benign Het
Npas1 G A 7: 16,208,725 (GRCm39) R51C probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
P2ry14 T C 3: 59,023,274 (GRCm39) N62S probably damaging Het
Pcdh15 A G 10: 74,460,087 (GRCm39) Y1308C probably damaging Het
Pcdhb14 A T 18: 37,582,588 (GRCm39) M565L probably benign Het
Pde6a A G 18: 61,390,283 (GRCm39) E502G probably damaging Het
Pde8b A G 13: 95,178,527 (GRCm39) V566A probably benign Het
Phf11b G T 14: 59,565,554 (GRCm39) Q108K probably benign Het
Pikfyve T C 1: 65,291,716 (GRCm39) Y1312H probably damaging Het
Plcb3 T C 19: 6,933,381 (GRCm39) probably benign Het
Plxna2 G A 1: 194,488,611 (GRCm39) G1629D probably damaging Het
Plxnb1 T C 9: 108,929,813 (GRCm39) V223A probably benign Het
Prkca A T 11: 107,903,518 (GRCm39) Y285N possibly damaging Het
Prl2a1 A T 13: 27,992,554 (GRCm39) N226I probably damaging Het
Pus7 A C 5: 23,946,914 (GRCm39) M636R probably damaging Het
Samd9l G A 6: 3,375,264 (GRCm39) Q666* probably null Het
Sema3d A G 5: 12,634,854 (GRCm39) D640G probably benign Het
Slc6a15 A G 10: 103,236,121 (GRCm39) I279V probably benign Het
Slk T C 19: 47,608,973 (GRCm39) V642A possibly damaging Het
Spata31e2 C A 1: 26,722,070 (GRCm39) G1037* probably null Het
Srrt T C 5: 137,301,274 (GRCm39) probably benign Het
Stfa2l1 A T 16: 35,977,228 (GRCm39) I8L probably benign Het
Tap1 T C 17: 34,413,899 (GRCm39) L638P probably benign Het
Tbccd1 A T 16: 22,640,995 (GRCm39) L461M probably benign Het
Tecta T C 9: 42,289,345 (GRCm39) T407A probably benign Het
Tmbim7 T C 5: 3,707,493 (GRCm39) probably null Het
Tnrc18 C A 5: 142,800,869 (GRCm39) V30L probably benign Het
Tomm7 A G 5: 24,049,025 (GRCm39) F16S probably damaging Het
Ugt2a2 A G 5: 87,622,315 (GRCm39) S428P probably benign Het
Vmn1r189 T C 13: 22,286,324 (GRCm39) E171G probably benign Het
Vmn1r61 T C 7: 5,614,324 (GRCm39) probably benign Het
Vmn2r120 A T 17: 57,832,038 (GRCm39) S250R probably benign Het
Vmn2r8 T C 5: 108,950,972 (GRCm39) R158G probably benign Het
Vmn2r98 A T 17: 19,286,702 (GRCm39) Y400F probably damaging Het
Vps13c C A 9: 67,801,267 (GRCm39) Y582* probably null Het
Zfp518a T A 19: 40,904,000 (GRCm39) F1310I probably benign Het
Zswim1 A G 2: 164,667,320 (GRCm39) I191V probably benign Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174,035,956 (GRCm39) nonsense probably null
IGL01095:Spta1 APN 1 174,041,051 (GRCm39) missense probably benign 0.02
IGL01144:Spta1 APN 1 174,014,829 (GRCm39) missense probably benign 0.05
IGL01455:Spta1 APN 1 174,030,877 (GRCm39) missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174,044,725 (GRCm39) missense probably benign 0.03
IGL01613:Spta1 APN 1 174,035,960 (GRCm39) missense probably damaging 1.00
IGL01804:Spta1 APN 1 174,071,746 (GRCm39) missense probably benign 0.42
IGL01859:Spta1 APN 1 174,001,938 (GRCm39) missense probably damaging 1.00
IGL01898:Spta1 APN 1 174,041,428 (GRCm39) missense probably benign 0.00
IGL02106:Spta1 APN 1 174,030,860 (GRCm39) missense probably benign 0.02
IGL02166:Spta1 APN 1 174,017,797 (GRCm39) missense probably damaging 1.00
IGL02224:Spta1 APN 1 174,045,255 (GRCm39) critical splice donor site probably benign
IGL02318:Spta1 APN 1 174,002,029 (GRCm39) missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174,046,380 (GRCm39) missense probably damaging 0.96
IGL02852:Spta1 APN 1 174,071,676 (GRCm39) missense probably benign 0.24
IGL02861:Spta1 APN 1 174,039,164 (GRCm39) missense probably damaging 1.00
IGL02982:Spta1 APN 1 174,014,854 (GRCm39) missense probably benign 0.00
IGL03057:Spta1 APN 1 174,008,624 (GRCm39) missense probably benign 0.19
IGL03215:Spta1 APN 1 174,046,309 (GRCm39) missense probably damaging 1.00
IGL03263:Spta1 APN 1 174,041,484 (GRCm39) missense probably damaging 0.99
IGL03272:Spta1 APN 1 174,041,710 (GRCm39) missense probably benign 0.08
bounced UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
Capillus UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
Deflection UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
Goldfoil UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
hanging UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
Klimt UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
Rutherford UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
Thread UTSW 1 174,025,201 (GRCm39) nonsense probably null
H8786:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0078:Spta1 UTSW 1 174,034,598 (GRCm39) splice site probably benign
R0172:Spta1 UTSW 1 174,058,352 (GRCm39) missense probably damaging 1.00
R0206:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0208:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0276:Spta1 UTSW 1 174,045,460 (GRCm39) missense probably damaging 1.00
R0288:Spta1 UTSW 1 174,070,745 (GRCm39) missense probably damaging 0.99
R0323:Spta1 UTSW 1 174,046,017 (GRCm39) missense probably damaging 1.00
R0454:Spta1 UTSW 1 174,041,508 (GRCm39) missense probably damaging 1.00
R0508:Spta1 UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
R0698:Spta1 UTSW 1 174,008,670 (GRCm39) missense probably damaging 1.00
R0751:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R0925:Spta1 UTSW 1 174,001,992 (GRCm39) missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174,072,771 (GRCm39) unclassified probably benign
R1131:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R1171:Spta1 UTSW 1 174,039,180 (GRCm39) nonsense probably null
R1184:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R1401:Spta1 UTSW 1 174,050,250 (GRCm39) missense probably damaging 1.00
R1489:Spta1 UTSW 1 174,058,891 (GRCm39) missense probably damaging 0.97
R1532:Spta1 UTSW 1 174,074,919 (GRCm39) missense probably damaging 0.99
R1551:Spta1 UTSW 1 174,067,732 (GRCm39) missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
R1566:Spta1 UTSW 1 174,012,272 (GRCm39) missense probably benign 0.00
R1586:Spta1 UTSW 1 174,041,061 (GRCm39) missense probably benign 0.00
R1676:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R1711:Spta1 UTSW 1 174,068,608 (GRCm39) missense probably damaging 1.00
R1823:Spta1 UTSW 1 174,074,115 (GRCm39) missense probably benign 0.05
R1842:Spta1 UTSW 1 174,023,513 (GRCm39) missense probably benign 0.00
R1867:Spta1 UTSW 1 174,047,405 (GRCm39) missense probably benign 0.33
R1970:Spta1 UTSW 1 174,067,933 (GRCm39) missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174,039,213 (GRCm39) missense probably benign 0.20
R2095:Spta1 UTSW 1 174,071,764 (GRCm39) missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174,035,910 (GRCm39) missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174,040,180 (GRCm39) missense probably benign 0.00
R2158:Spta1 UTSW 1 174,056,824 (GRCm39) missense probably benign 0.41
R2187:Spta1 UTSW 1 174,020,532 (GRCm39) missense probably damaging 1.00
R2250:Spta1 UTSW 1 174,071,680 (GRCm39) missense probably damaging 1.00
R2258:Spta1 UTSW 1 174,001,907 (GRCm39) missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174,006,222 (GRCm39) critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R4058:Spta1 UTSW 1 174,068,703 (GRCm39) missense probably damaging 1.00
R4080:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4081:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4082:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4108:Spta1 UTSW 1 174,002,122 (GRCm39) missense probably benign 0.01
R4115:Spta1 UTSW 1 174,067,923 (GRCm39) missense probably damaging 1.00
R4303:Spta1 UTSW 1 174,007,418 (GRCm39) missense probably damaging 1.00
R4419:Spta1 UTSW 1 174,074,990 (GRCm39) nonsense probably null
R4525:Spta1 UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
R4614:Spta1 UTSW 1 174,020,543 (GRCm39) missense probably damaging 1.00
R4673:Spta1 UTSW 1 174,018,628 (GRCm39) splice site probably null
R4782:Spta1 UTSW 1 174,058,232 (GRCm39) missense probably benign 0.01
R4825:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174,065,493 (GRCm39) missense probably benign 0.01
R4873:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4875:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4898:Spta1 UTSW 1 174,065,400 (GRCm39) missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174,045,429 (GRCm39) splice site probably null
R4911:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R4928:Spta1 UTSW 1 174,018,622 (GRCm39) missense probably benign 0.15
R4959:Spta1 UTSW 1 174,074,174 (GRCm39) missense probably damaging 0.97
R5009:Spta1 UTSW 1 174,067,789 (GRCm39) missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174,075,000 (GRCm39) missense probably damaging 0.99
R5293:Spta1 UTSW 1 174,023,551 (GRCm39) missense probably damaging 0.99
R5421:Spta1 UTSW 1 174,043,095 (GRCm39) missense probably damaging 0.99
R5457:Spta1 UTSW 1 174,044,759 (GRCm39) missense probably damaging 1.00
R5590:Spta1 UTSW 1 174,003,336 (GRCm39) missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174,047,468 (GRCm39) missense probably damaging 1.00
R5736:Spta1 UTSW 1 174,041,821 (GRCm39) critical splice donor site probably null
R5834:Spta1 UTSW 1 174,012,363 (GRCm39) splice site probably null
R5845:Spta1 UTSW 1 174,068,662 (GRCm39) missense probably damaging 0.97
R5987:Spta1 UTSW 1 174,050,894 (GRCm39) missense probably damaging 1.00
R6102:Spta1 UTSW 1 174,052,086 (GRCm39) missense probably benign 0.01
R6221:Spta1 UTSW 1 174,009,342 (GRCm39) missense probably damaging 1.00
R6276:Spta1 UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
R6317:Spta1 UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
R6329:Spta1 UTSW 1 174,041,743 (GRCm39) missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174,039,212 (GRCm39) missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174,041,734 (GRCm39) missense probably damaging 1.00
R6376:Spta1 UTSW 1 174,030,888 (GRCm39) missense probably benign
R6387:Spta1 UTSW 1 174,058,899 (GRCm39) missense probably benign 0.01
R6451:Spta1 UTSW 1 174,044,767 (GRCm39) missense probably damaging 0.97
R6480:Spta1 UTSW 1 174,014,714 (GRCm39) splice site probably null
R6533:Spta1 UTSW 1 174,071,713 (GRCm39) missense probably damaging 1.00
R6585:Spta1 UTSW 1 174,006,251 (GRCm39) missense probably damaging 1.00
R6695:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174,036,891 (GRCm39) missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174,036,918 (GRCm39) missense probably damaging 1.00
R7086:Spta1 UTSW 1 174,027,050 (GRCm39) missense probably damaging 0.98
R7087:Spta1 UTSW 1 174,002,076 (GRCm39) missense probably benign
R7151:Spta1 UTSW 1 174,025,317 (GRCm39) missense probably damaging 1.00
R7193:Spta1 UTSW 1 174,012,178 (GRCm39) missense probably damaging 1.00
R7199:Spta1 UTSW 1 174,050,837 (GRCm39) missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174,050,203 (GRCm39) missense probably damaging 0.96
R7343:Spta1 UTSW 1 174,050,915 (GRCm39) missense probably damaging 0.99
R7372:Spta1 UTSW 1 174,025,201 (GRCm39) nonsense probably null
R7472:Spta1 UTSW 1 174,074,065 (GRCm39) missense probably damaging 1.00
R7516:Spta1 UTSW 1 174,025,349 (GRCm39) missense probably damaging 1.00
R7627:Spta1 UTSW 1 174,032,944 (GRCm39) missense probably damaging 1.00
R7770:Spta1 UTSW 1 174,023,547 (GRCm39) nonsense probably null
R7784:Spta1 UTSW 1 174,030,017 (GRCm39) missense probably damaging 1.00
R7804:Spta1 UTSW 1 174,023,471 (GRCm39) missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174,046,396 (GRCm39) critical splice donor site probably null
R7862:Spta1 UTSW 1 174,025,351 (GRCm39) critical splice donor site probably null
R7958:Spta1 UTSW 1 174,001,956 (GRCm39) missense probably benign 0.03
R8015:Spta1 UTSW 1 174,067,737 (GRCm39) missense probably damaging 1.00
R8059:Spta1 UTSW 1 174,045,936 (GRCm39) intron probably benign
R8076:Spta1 UTSW 1 174,014,797 (GRCm39) missense probably benign 0.00
R8152:Spta1 UTSW 1 174,045,510 (GRCm39) missense probably benign 0.03
R8235:Spta1 UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
R8284:Spta1 UTSW 1 174,007,387 (GRCm39) missense probably benign 0.00
R8298:Spta1 UTSW 1 174,074,953 (GRCm39) missense probably damaging 1.00
R8312:Spta1 UTSW 1 174,067,777 (GRCm39) missense probably damaging 1.00
R8495:Spta1 UTSW 1 174,043,051 (GRCm39) missense probably benign 0.00
R8550:Spta1 UTSW 1 174,014,774 (GRCm39) missense probably damaging 1.00
R8675:Spta1 UTSW 1 174,058,249 (GRCm39) missense probably benign 0.01
R8757:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8759:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8848:Spta1 UTSW 1 174,025,310 (GRCm39) missense probably benign 0.05
R8883:Spta1 UTSW 1 174,021,145 (GRCm39) missense possibly damaging 0.82
R8884:Spta1 UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
R8896:Spta1 UTSW 1 174,045,548 (GRCm39) missense probably damaging 1.00
R8953:Spta1 UTSW 1 174,058,241 (GRCm39) missense probably benign 0.10
R9006:Spta1 UTSW 1 174,047,537 (GRCm39) missense probably damaging 1.00
R9013:Spta1 UTSW 1 174,050,174 (GRCm39) missense probably damaging 1.00
R9077:Spta1 UTSW 1 174,045,170 (GRCm39) missense probably damaging 1.00
R9129:Spta1 UTSW 1 174,058,911 (GRCm39) missense possibly damaging 0.77
R9207:Spta1 UTSW 1 174,039,139 (GRCm39) missense probably benign 0.01
R9229:Spta1 UTSW 1 174,067,750 (GRCm39) missense probably damaging 1.00
R9281:Spta1 UTSW 1 174,047,444 (GRCm39) missense probably damaging 1.00
R9290:Spta1 UTSW 1 174,045,204 (GRCm39) missense possibly damaging 0.94
R9307:Spta1 UTSW 1 174,035,978 (GRCm39) missense probably damaging 1.00
R9489:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9605:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9685:Spta1 UTSW 1 174,032,925 (GRCm39) missense probably damaging 1.00
RF002:Spta1 UTSW 1 174,058,926 (GRCm39) missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174,036,885 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,045,469 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,041,010 (GRCm39) missense probably benign 0.42
T0722:Spta1 UTSW 1 174,018,632 (GRCm39) splice site probably benign
X0028:Spta1 UTSW 1 174,052,016 (GRCm39) missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174,067,933 (GRCm39) missense probably damaging 0.99
Z1176:Spta1 UTSW 1 174,018,617 (GRCm39) missense probably damaging 1.00
Z1177:Spta1 UTSW 1 174,073,255 (GRCm39) missense probably benign 0.02
Z1177:Spta1 UTSW 1 174,017,728 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCGTAATATTATAGCATGTCACTG -3'
(R):5'- TTGGGGACAGTGCCATTTAC -3'

Sequencing Primer
(F):5'- TATAGCATGTCACTGAAGAACTAGG -3'
(R):5'- GGGACAGTGCCATTTACTTCTGAAC -3'
Posted On 2014-06-23