Incidental Mutation 'R1795:Plxna2'
ID202098
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission 039825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1795 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 194806303 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1629 (G1629D)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027952
AA Change: G1629D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: G1629D

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124785
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,682,989 G1037* probably null Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Abcg5 A G 17: 84,673,579 I194T probably damaging Het
Abtb2 A G 2: 103,567,024 T100A probably benign Het
Adam4 C T 12: 81,421,294 M184I probably benign Het
Afap1l2 T C 19: 56,928,409 D155G probably damaging Het
Ahnak T C 19: 9,002,438 V362A possibly damaging Het
Ak7 C T 12: 105,726,223 R179* probably null Het
Akap8 C A 17: 32,315,477 G332C probably damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Ankrd12 T C 17: 65,986,227 E737G possibly damaging Het
Atrn A G 2: 130,972,288 D718G probably benign Het
Bco2 A G 9: 50,541,169 S200P possibly damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdc14a T A 3: 116,298,473 Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Celsr1 A T 15: 86,030,323 S1150T probably damaging Het
Cntfr A G 4: 41,670,841 probably null Het
Cramp1l T C 17: 24,964,910 N1244D probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Cyp4f17 A T 17: 32,517,969 I92F probably benign Het
Dhx30 A T 9: 110,107,983 probably null Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dmgdh A T 13: 93,706,699 M348L probably benign Het
Dnmt3b G A 2: 153,683,639 E741K possibly damaging Het
Dock3 T G 9: 107,025,335 H292P probably damaging Het
Elmsan1 A G 12: 84,158,974 probably null Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Etl4 T C 2: 20,808,026 probably null Het
Exoc7 A T 11: 116,292,521 I498N probably damaging Het
Fap G A 2: 62,548,589 S123L probably damaging Het
Foxn1 T C 11: 78,371,225 E106G probably benign Het
Fscb T A 12: 64,474,401 D97V probably damaging Het
Gabrg1 T C 5: 70,782,253 T174A possibly damaging Het
Gan C T 8: 117,196,460 A461V possibly damaging Het
Gbp2 T A 3: 142,630,523 D211E possibly damaging Het
Gm10271 A T 10: 116,956,841 Y47N unknown Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm1758 T A 16: 14,502,278 noncoding transcript Het
Golga3 A G 5: 110,207,627 K989R possibly damaging Het
Gucy2g C A 19: 55,199,541 V1041F probably damaging Het
Guk1 A T 11: 59,186,813 F25I probably benign Het
H2al1o C T X: 9,572,090 E87K possibly damaging Het
Hemgn C A 4: 46,395,958 C426F probably damaging Het
Hps3 A G 3: 20,012,695 probably null Het
Il2rb A T 15: 78,483,987 D287E probably damaging Het
Ino80 A T 2: 119,406,859 V1123D probably damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif21a A T 15: 90,972,727 probably null Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Krt2 A G 15: 101,816,426 F250L possibly damaging Het
Krt82 T A 15: 101,543,384 N332I possibly damaging Het
Lgi1 A G 19: 38,306,183 I444V probably benign Het
Lmod1 G A 1: 135,325,124 V39M probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Mlxipl A C 5: 135,107,170 D83A probably damaging Het
Mroh8 T A 2: 157,269,551 E161V probably benign Het
Mroh9 G A 1: 163,056,778 T397I probably damaging Het
Mtss1 T C 15: 59,058,400 D32G possibly damaging Het
Mus81 T C 19: 5,483,476 D495G probably benign Het
Neurod1 A C 2: 79,454,329 S237A probably benign Het
Npas1 G A 7: 16,474,800 R51C probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
P2ry14 T C 3: 59,115,853 N62S probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcdhb14 A T 18: 37,449,535 M565L probably benign Het
Pde6a A G 18: 61,257,212 E502G probably damaging Het
Pde8b A G 13: 95,042,019 V566A probably benign Het
Phf11b G T 14: 59,328,105 Q108K probably benign Het
Pikfyve T C 1: 65,252,557 Y1312H probably damaging Het
Plcb3 T C 19: 6,956,013 probably benign Het
Plxnb1 T C 9: 109,100,745 V223A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Prl2a1 A T 13: 27,808,571 N226I probably damaging Het
Pus7 A C 5: 23,741,916 M636R probably damaging Het
Samd9l G A 6: 3,375,264 Q666* probably null Het
Sema3d A G 5: 12,584,887 D640G probably benign Het
Slc6a15 A G 10: 103,400,260 I279V probably benign Het
Slk T C 19: 47,620,534 V642A possibly damaging Het
Spta1 T A 1: 174,245,730 M2305K probably damaging Het
Srrt T C 5: 137,303,012 probably benign Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Tap1 T C 17: 34,194,925 L638P probably benign Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tecta T C 9: 42,378,049 T407A probably benign Het
Tmbim7 T C 5: 3,657,493 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ugt2a2 A G 5: 87,474,456 S428P probably benign Het
Vmn1r189 T C 13: 22,102,154 E171G probably benign Het
Vmn1r61 T C 7: 5,611,325 probably benign Het
Vmn2r120 A T 17: 57,525,038 S250R probably benign Het
Vmn2r8 T C 5: 108,803,106 R158G probably benign Het
Vmn2r98 A T 17: 19,066,440 Y400F probably damaging Het
Vps13c C A 9: 67,893,985 Y582* probably null Het
Zfp518a T A 19: 40,915,556 F1310I probably benign Het
Zswim1 A G 2: 164,825,400 I191V probably benign Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194643871 missense probably benign 0.25
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATTTCCTCTTTCCAACCAAGGATC -3'
(R):5'- TTAGGGAACAGCTTGGCCTG -3'

Sequencing Primer
(F):5'- TCTTTCCAACCAAGGATCCATAAAC -3'
(R):5'- CCTGGGCTGTGCAAGAATTAC -3'
Posted On2014-06-23