Incidental Mutation 'R1795:Ino80'
ID202104
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 039825-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R1795 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119406859 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1123 (V1123D)
Ref Sequence ENSEMBL: ENSMUSP00000106431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
Predicted Effect probably damaging
Transcript: ENSMUST00000049920
AA Change: V1123D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: V1123D

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110808
AA Change: V1123D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: V1123D

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,682,989 G1037* probably null Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Abcg5 A G 17: 84,673,579 I194T probably damaging Het
Abtb2 A G 2: 103,567,024 T100A probably benign Het
Adam4 C T 12: 81,421,294 M184I probably benign Het
Afap1l2 T C 19: 56,928,409 D155G probably damaging Het
Ahnak T C 19: 9,002,438 V362A possibly damaging Het
Ak7 C T 12: 105,726,223 R179* probably null Het
Akap8 C A 17: 32,315,477 G332C probably damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Ankrd12 T C 17: 65,986,227 E737G possibly damaging Het
Atrn A G 2: 130,972,288 D718G probably benign Het
Bco2 A G 9: 50,541,169 S200P possibly damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdc14a T A 3: 116,298,473 Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Celsr1 A T 15: 86,030,323 S1150T probably damaging Het
Cntfr A G 4: 41,670,841 probably null Het
Cramp1l T C 17: 24,964,910 N1244D probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Cyp4f17 A T 17: 32,517,969 I92F probably benign Het
Dhx30 A T 9: 110,107,983 probably null Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dmgdh A T 13: 93,706,699 M348L probably benign Het
Dnmt3b G A 2: 153,683,639 E741K possibly damaging Het
Dock3 T G 9: 107,025,335 H292P probably damaging Het
Elmsan1 A G 12: 84,158,974 probably null Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Etl4 T C 2: 20,808,026 probably null Het
Exoc7 A T 11: 116,292,521 I498N probably damaging Het
Fap G A 2: 62,548,589 S123L probably damaging Het
Foxn1 T C 11: 78,371,225 E106G probably benign Het
Fscb T A 12: 64,474,401 D97V probably damaging Het
Gabrg1 T C 5: 70,782,253 T174A possibly damaging Het
Gan C T 8: 117,196,460 A461V possibly damaging Het
Gbp2 T A 3: 142,630,523 D211E possibly damaging Het
Gm10271 A T 10: 116,956,841 Y47N unknown Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm1758 T A 16: 14,502,278 noncoding transcript Het
Golga3 A G 5: 110,207,627 K989R possibly damaging Het
Gucy2g C A 19: 55,199,541 V1041F probably damaging Het
Guk1 A T 11: 59,186,813 F25I probably benign Het
H2al1o C T X: 9,572,090 E87K possibly damaging Het
Hemgn C A 4: 46,395,958 C426F probably damaging Het
Hps3 A G 3: 20,012,695 probably null Het
Il2rb A T 15: 78,483,987 D287E probably damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif21a A T 15: 90,972,727 probably null Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Krt2 A G 15: 101,816,426 F250L possibly damaging Het
Krt82 T A 15: 101,543,384 N332I possibly damaging Het
Lgi1 A G 19: 38,306,183 I444V probably benign Het
Lmod1 G A 1: 135,325,124 V39M probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Mlxipl A C 5: 135,107,170 D83A probably damaging Het
Mroh8 T A 2: 157,269,551 E161V probably benign Het
Mroh9 G A 1: 163,056,778 T397I probably damaging Het
Mtss1 T C 15: 59,058,400 D32G possibly damaging Het
Mus81 T C 19: 5,483,476 D495G probably benign Het
Neurod1 A C 2: 79,454,329 S237A probably benign Het
Npas1 G A 7: 16,474,800 R51C probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
P2ry14 T C 3: 59,115,853 N62S probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcdhb14 A T 18: 37,449,535 M565L probably benign Het
Pde6a A G 18: 61,257,212 E502G probably damaging Het
Pde8b A G 13: 95,042,019 V566A probably benign Het
Phf11b G T 14: 59,328,105 Q108K probably benign Het
Pikfyve T C 1: 65,252,557 Y1312H probably damaging Het
Plcb3 T C 19: 6,956,013 probably benign Het
Plxna2 G A 1: 194,806,303 G1629D probably damaging Het
Plxnb1 T C 9: 109,100,745 V223A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Prl2a1 A T 13: 27,808,571 N226I probably damaging Het
Pus7 A C 5: 23,741,916 M636R probably damaging Het
Samd9l G A 6: 3,375,264 Q666* probably null Het
Sema3d A G 5: 12,584,887 D640G probably benign Het
Slc6a15 A G 10: 103,400,260 I279V probably benign Het
Slk T C 19: 47,620,534 V642A possibly damaging Het
Spta1 T A 1: 174,245,730 M2305K probably damaging Het
Srrt T C 5: 137,303,012 probably benign Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Tap1 T C 17: 34,194,925 L638P probably benign Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tecta T C 9: 42,378,049 T407A probably benign Het
Tmbim7 T C 5: 3,657,493 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ugt2a2 A G 5: 87,474,456 S428P probably benign Het
Vmn1r189 T C 13: 22,102,154 E171G probably benign Het
Vmn1r61 T C 7: 5,611,325 probably benign Het
Vmn2r120 A T 17: 57,525,038 S250R probably benign Het
Vmn2r8 T C 5: 108,803,106 R158G probably benign Het
Vmn2r98 A T 17: 19,066,440 Y400F probably damaging Het
Vps13c C A 9: 67,893,985 Y582* probably null Het
Zfp518a T A 19: 40,915,556 F1310I probably benign Het
Zswim1 A G 2: 164,825,400 I191V probably benign Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
chosen UTSW 2 119382269 splice site probably null
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7607:Ino80 UTSW 2 119382269 splice site probably null
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
R7975:Ino80 UTSW 2 119456467 splice site probably null
R7978:Ino80 UTSW 2 119439393 missense possibly damaging 0.93
R8376:Ino80 UTSW 2 119442487 missense probably benign 0.14
R8469:Ino80 UTSW 2 119379593
Predicted Primers PCR Primer
(F):5'- TAGAAGTCCTCTGCATTATTGGGG -3'
(R):5'- CCTGTTCCAATGAGACAAGCATC -3'

Sequencing Primer
(F):5'- AGGGACACCAGATTCCTA -3'
(R):5'- CAATGAGACAAGCATCCTGATAATAG -3'
Posted On2014-06-23