Incidental Mutation 'R1795:Vmn2r8'
ID 202122
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Name vomeronasal 2, receptor 8
Synonyms EG627479
MMRRC Submission 039825-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1795 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 108945059-108956620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108950972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 158 (R158G)
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172140]
AlphaFold L7N472
Predicted Effect probably benign
Transcript: ENSMUST00000172140
AA Change: R158G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: R158G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,941,792 (GRCm39) I1159T probably benign Het
Abcc1 T C 16: 14,283,001 (GRCm39) V1159A possibly damaging Het
Abcg5 A G 17: 84,981,007 (GRCm39) I194T probably damaging Het
Abtb2 A G 2: 103,397,369 (GRCm39) T100A probably benign Het
Adam4 C T 12: 81,468,068 (GRCm39) M184I probably benign Het
Afap1l2 T C 19: 56,916,841 (GRCm39) D155G probably damaging Het
Ahnak T C 19: 8,979,802 (GRCm39) V362A possibly damaging Het
Ak7 C T 12: 105,692,482 (GRCm39) R179* probably null Het
Akap8 C A 17: 32,534,451 (GRCm39) G332C probably damaging Het
Akr1e1 T A 13: 4,645,071 (GRCm39) Q204L probably damaging Het
Ankrd12 T C 17: 66,293,222 (GRCm39) E737G possibly damaging Het
Atrn A G 2: 130,814,208 (GRCm39) D718G probably benign Het
Bco2 A G 9: 50,452,469 (GRCm39) S200P possibly damaging Het
C030005K15Rik A T 10: 97,561,648 (GRCm39) S28T unknown Het
Cdc14a T A 3: 116,092,122 (GRCm39) Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,799,654 (GRCm39) L387P probably damaging Het
Celsr1 A T 15: 85,914,524 (GRCm39) S1150T probably damaging Het
Cntfr A G 4: 41,670,841 (GRCm39) probably null Het
Cramp1 T C 17: 25,183,884 (GRCm39) N1244D probably damaging Het
Csmd3 G T 15: 47,721,316 (GRCm39) D1542E possibly damaging Het
Cyp4f17 A T 17: 32,736,943 (GRCm39) I92F probably benign Het
Dhx30 A T 9: 109,937,051 (GRCm39) probably null Het
Dlg1 T A 16: 31,561,965 (GRCm39) H120Q probably benign Het
Dmgdh A T 13: 93,843,207 (GRCm39) M348L probably benign Het
Dnmt3b G A 2: 153,525,559 (GRCm39) E741K possibly damaging Het
Dock3 T G 9: 106,902,534 (GRCm39) H292P probably damaging Het
Ercc6 T A 14: 32,238,985 (GRCm39) N24K probably benign Het
Esco2 T C 14: 66,064,726 (GRCm39) Q338R probably benign Het
Etl4 T C 2: 20,812,837 (GRCm39) probably null Het
Exoc7 A T 11: 116,183,347 (GRCm39) I498N probably damaging Het
Fap G A 2: 62,378,933 (GRCm39) S123L probably damaging Het
Foxn1 T C 11: 78,262,051 (GRCm39) E106G probably benign Het
Fscb T A 12: 64,521,175 (GRCm39) D97V probably damaging Het
Gabrg1 T C 5: 70,939,596 (GRCm39) T174A possibly damaging Het
Gan C T 8: 117,923,199 (GRCm39) A461V possibly damaging Het
Gbp2 T A 3: 142,336,284 (GRCm39) D211E possibly damaging Het
Gm10271 A T 10: 116,792,746 (GRCm39) Y47N unknown Het
Gm17333 G T 16: 77,649,711 (GRCm39) noncoding transcript Het
Gm1758 T A 16: 14,320,142 (GRCm39) noncoding transcript Het
Golga3 A G 5: 110,355,493 (GRCm39) K989R possibly damaging Het
Gucy2g C A 19: 55,187,973 (GRCm39) V1041F probably damaging Het
Guk1 A T 11: 59,077,639 (GRCm39) F25I probably benign Het
H2al1o C T X: 9,438,329 (GRCm39) E87K possibly damaging Het
Hemgn C A 4: 46,395,958 (GRCm39) C426F probably damaging Het
Hps3 A G 3: 20,066,859 (GRCm39) probably null Het
Il2rb A T 15: 78,368,187 (GRCm39) D287E probably damaging Het
Ino80 A T 2: 119,237,340 (GRCm39) V1123D probably damaging Het
Kdm2b A G 5: 123,122,523 (GRCm39) probably null Het
Kif21a A T 15: 90,856,930 (GRCm39) probably null Het
Klhl33 A T 14: 51,129,583 (GRCm39) N347K probably damaging Het
Krt1c A G 15: 101,724,861 (GRCm39) F250L possibly damaging Het
Krt82 T A 15: 101,451,819 (GRCm39) N332I possibly damaging Het
Lgi1 A G 19: 38,294,631 (GRCm39) I444V probably benign Het
Lmod1 G A 1: 135,252,862 (GRCm39) V39M probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mex3d T C 10: 80,217,376 (GRCm39) T149A probably benign Het
Mideas A G 12: 84,205,748 (GRCm39) probably null Het
Mlxipl A C 5: 135,136,024 (GRCm39) D83A probably damaging Het
Mroh8 T A 2: 157,111,471 (GRCm39) E161V probably benign Het
Mroh9 G A 1: 162,884,347 (GRCm39) T397I probably damaging Het
Mtss1 T C 15: 58,930,249 (GRCm39) D32G possibly damaging Het
Mus81 T C 19: 5,533,504 (GRCm39) D495G probably benign Het
Neurod1 A C 2: 79,284,673 (GRCm39) S237A probably benign Het
Npas1 G A 7: 16,208,725 (GRCm39) R51C probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
P2ry14 T C 3: 59,023,274 (GRCm39) N62S probably damaging Het
Pcdh15 A G 10: 74,460,087 (GRCm39) Y1308C probably damaging Het
Pcdhb14 A T 18: 37,582,588 (GRCm39) M565L probably benign Het
Pde6a A G 18: 61,390,283 (GRCm39) E502G probably damaging Het
Pde8b A G 13: 95,178,527 (GRCm39) V566A probably benign Het
Phf11b G T 14: 59,565,554 (GRCm39) Q108K probably benign Het
Pikfyve T C 1: 65,291,716 (GRCm39) Y1312H probably damaging Het
Plcb3 T C 19: 6,933,381 (GRCm39) probably benign Het
Plxna2 G A 1: 194,488,611 (GRCm39) G1629D probably damaging Het
Plxnb1 T C 9: 108,929,813 (GRCm39) V223A probably benign Het
Prkca A T 11: 107,903,518 (GRCm39) Y285N possibly damaging Het
Prl2a1 A T 13: 27,992,554 (GRCm39) N226I probably damaging Het
Pus7 A C 5: 23,946,914 (GRCm39) M636R probably damaging Het
Samd9l G A 6: 3,375,264 (GRCm39) Q666* probably null Het
Sema3d A G 5: 12,634,854 (GRCm39) D640G probably benign Het
Slc6a15 A G 10: 103,236,121 (GRCm39) I279V probably benign Het
Slk T C 19: 47,608,973 (GRCm39) V642A possibly damaging Het
Spata31e2 C A 1: 26,722,070 (GRCm39) G1037* probably null Het
Spta1 T A 1: 174,073,296 (GRCm39) M2305K probably damaging Het
Srrt T C 5: 137,301,274 (GRCm39) probably benign Het
Stfa2l1 A T 16: 35,977,228 (GRCm39) I8L probably benign Het
Tap1 T C 17: 34,413,899 (GRCm39) L638P probably benign Het
Tbccd1 A T 16: 22,640,995 (GRCm39) L461M probably benign Het
Tecta T C 9: 42,289,345 (GRCm39) T407A probably benign Het
Tmbim7 T C 5: 3,707,493 (GRCm39) probably null Het
Tnrc18 C A 5: 142,800,869 (GRCm39) V30L probably benign Het
Tomm7 A G 5: 24,049,025 (GRCm39) F16S probably damaging Het
Ugt2a2 A G 5: 87,622,315 (GRCm39) S428P probably benign Het
Vmn1r189 T C 13: 22,286,324 (GRCm39) E171G probably benign Het
Vmn1r61 T C 7: 5,614,324 (GRCm39) probably benign Het
Vmn2r120 A T 17: 57,832,038 (GRCm39) S250R probably benign Het
Vmn2r98 A T 17: 19,286,702 (GRCm39) Y400F probably damaging Het
Vps13c C A 9: 67,801,267 (GRCm39) Y582* probably null Het
Zfp518a T A 19: 40,904,000 (GRCm39) F1310I probably benign Het
Zswim1 A G 2: 164,667,320 (GRCm39) I191V probably benign Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108,950,091 (GRCm39) missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108,945,807 (GRCm39) splice site probably null
R0335:Vmn2r8 UTSW 5 108,945,317 (GRCm39) splice site probably null
R0394:Vmn2r8 UTSW 5 108,949,938 (GRCm39) missense probably benign 0.12
R0501:Vmn2r8 UTSW 5 108,951,049 (GRCm39) missense probably benign 0.03
R0615:Vmn2r8 UTSW 5 108,947,195 (GRCm39) missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108,948,412 (GRCm39) missense probably benign 0.00
R1167:Vmn2r8 UTSW 5 108,951,042 (GRCm39) missense probably benign 0.01
R1187:Vmn2r8 UTSW 5 108,951,085 (GRCm39) nonsense probably null
R1406:Vmn2r8 UTSW 5 108,950,234 (GRCm39) missense probably benign
R1406:Vmn2r8 UTSW 5 108,950,234 (GRCm39) missense probably benign
R1451:Vmn2r8 UTSW 5 108,945,933 (GRCm39) missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108,950,040 (GRCm39) missense probably damaging 1.00
R1874:Vmn2r8 UTSW 5 108,950,284 (GRCm39) missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108,945,436 (GRCm39) missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108,950,019 (GRCm39) missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108,947,152 (GRCm39) missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108,945,961 (GRCm39) missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108,950,249 (GRCm39) missense probably benign 0.01
R2095:Vmn2r8 UTSW 5 108,956,487 (GRCm39) missense possibly damaging 0.94
R2159:Vmn2r8 UTSW 5 108,950,169 (GRCm39) missense probably benign 0.22
R4240:Vmn2r8 UTSW 5 108,945,369 (GRCm39) missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108,949,570 (GRCm39) missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108,956,447 (GRCm39) missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108,949,566 (GRCm39) missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108,945,264 (GRCm39) missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108,947,129 (GRCm39) missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108,956,572 (GRCm39) missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108,949,636 (GRCm39) missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108,950,106 (GRCm39) missense probably damaging 1.00
R5624:Vmn2r8 UTSW 5 108,950,325 (GRCm39) missense probably damaging 0.99
R6003:Vmn2r8 UTSW 5 108,945,248 (GRCm39) missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108,947,211 (GRCm39) missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108,956,463 (GRCm39) missense probably benign
R6315:Vmn2r8 UTSW 5 108,949,757 (GRCm39) missense probably benign
R6413:Vmn2r8 UTSW 5 108,949,589 (GRCm39) missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108,956,504 (GRCm39) missense possibly damaging 0.56
R7406:Vmn2r8 UTSW 5 108,948,442 (GRCm39) missense probably benign 0.00
R7409:Vmn2r8 UTSW 5 108,956,449 (GRCm39) nonsense probably null
R7489:Vmn2r8 UTSW 5 108,945,522 (GRCm39) missense possibly damaging 0.95
R7532:Vmn2r8 UTSW 5 108,950,106 (GRCm39) missense probably benign 0.22
R7534:Vmn2r8 UTSW 5 108,950,040 (GRCm39) missense possibly damaging 0.94
R7739:Vmn2r8 UTSW 5 108,950,043 (GRCm39) missense probably damaging 1.00
R8099:Vmn2r8 UTSW 5 108,949,700 (GRCm39) missense probably benign
R8245:Vmn2r8 UTSW 5 108,945,936 (GRCm39) missense probably damaging 1.00
R8711:Vmn2r8 UTSW 5 108,945,962 (GRCm39) missense possibly damaging 0.89
R8781:Vmn2r8 UTSW 5 108,945,597 (GRCm39) missense possibly damaging 0.95
R8874:Vmn2r8 UTSW 5 108,956,617 (GRCm39) missense probably damaging 1.00
R8927:Vmn2r8 UTSW 5 108,950,131 (GRCm39) missense
R8928:Vmn2r8 UTSW 5 108,950,131 (GRCm39) missense
R9288:Vmn2r8 UTSW 5 108,950,185 (GRCm39) missense probably benign 0.39
R9596:Vmn2r8 UTSW 5 108,947,196 (GRCm39) missense possibly damaging 0.94
R9652:Vmn2r8 UTSW 5 108,951,107 (GRCm39) missense probably benign 0.18
Z1088:Vmn2r8 UTSW 5 108,949,864 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTTTCAGGCACGTGTAAATG -3'
(R):5'- ACATGTCTTTGATAGTCTGGCTTC -3'

Sequencing Primer
(F):5'- GAGGTCCTAAGTTCAATTCCCAGG -3'
(R):5'- ATAGTCTGGCTTCTTAGTGGTCAG -3'
Posted On 2014-06-23