Incidental Mutation 'R1795:Samd9l'
ID 202128
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Name sterile alpha motif domain containing 9-like
Synonyms ESTM25
MMRRC Submission 039825-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1795 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 3372257-3399571 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 3375264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 666 (Q666*)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000120087
AA Change: Q666*
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: Q666*

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,941,792 (GRCm39) I1159T probably benign Het
Abcc1 T C 16: 14,283,001 (GRCm39) V1159A possibly damaging Het
Abcg5 A G 17: 84,981,007 (GRCm39) I194T probably damaging Het
Abtb2 A G 2: 103,397,369 (GRCm39) T100A probably benign Het
Adam4 C T 12: 81,468,068 (GRCm39) M184I probably benign Het
Afap1l2 T C 19: 56,916,841 (GRCm39) D155G probably damaging Het
Ahnak T C 19: 8,979,802 (GRCm39) V362A possibly damaging Het
Ak7 C T 12: 105,692,482 (GRCm39) R179* probably null Het
Akap8 C A 17: 32,534,451 (GRCm39) G332C probably damaging Het
Akr1e1 T A 13: 4,645,071 (GRCm39) Q204L probably damaging Het
Ankrd12 T C 17: 66,293,222 (GRCm39) E737G possibly damaging Het
Atrn A G 2: 130,814,208 (GRCm39) D718G probably benign Het
Bco2 A G 9: 50,452,469 (GRCm39) S200P possibly damaging Het
C030005K15Rik A T 10: 97,561,648 (GRCm39) S28T unknown Het
Cdc14a T A 3: 116,092,122 (GRCm39) Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,799,654 (GRCm39) L387P probably damaging Het
Celsr1 A T 15: 85,914,524 (GRCm39) S1150T probably damaging Het
Cntfr A G 4: 41,670,841 (GRCm39) probably null Het
Cramp1 T C 17: 25,183,884 (GRCm39) N1244D probably damaging Het
Csmd3 G T 15: 47,721,316 (GRCm39) D1542E possibly damaging Het
Cyp4f17 A T 17: 32,736,943 (GRCm39) I92F probably benign Het
Dhx30 A T 9: 109,937,051 (GRCm39) probably null Het
Dlg1 T A 16: 31,561,965 (GRCm39) H120Q probably benign Het
Dmgdh A T 13: 93,843,207 (GRCm39) M348L probably benign Het
Dnmt3b G A 2: 153,525,559 (GRCm39) E741K possibly damaging Het
Dock3 T G 9: 106,902,534 (GRCm39) H292P probably damaging Het
Ercc6 T A 14: 32,238,985 (GRCm39) N24K probably benign Het
Esco2 T C 14: 66,064,726 (GRCm39) Q338R probably benign Het
Etl4 T C 2: 20,812,837 (GRCm39) probably null Het
Exoc7 A T 11: 116,183,347 (GRCm39) I498N probably damaging Het
Fap G A 2: 62,378,933 (GRCm39) S123L probably damaging Het
Foxn1 T C 11: 78,262,051 (GRCm39) E106G probably benign Het
Fscb T A 12: 64,521,175 (GRCm39) D97V probably damaging Het
Gabrg1 T C 5: 70,939,596 (GRCm39) T174A possibly damaging Het
Gan C T 8: 117,923,199 (GRCm39) A461V possibly damaging Het
Gbp2 T A 3: 142,336,284 (GRCm39) D211E possibly damaging Het
Gm10271 A T 10: 116,792,746 (GRCm39) Y47N unknown Het
Gm17333 G T 16: 77,649,711 (GRCm39) noncoding transcript Het
Gm1758 T A 16: 14,320,142 (GRCm39) noncoding transcript Het
Golga3 A G 5: 110,355,493 (GRCm39) K989R possibly damaging Het
Gucy2g C A 19: 55,187,973 (GRCm39) V1041F probably damaging Het
Guk1 A T 11: 59,077,639 (GRCm39) F25I probably benign Het
H2al1o C T X: 9,438,329 (GRCm39) E87K possibly damaging Het
Hemgn C A 4: 46,395,958 (GRCm39) C426F probably damaging Het
Hps3 A G 3: 20,066,859 (GRCm39) probably null Het
Il2rb A T 15: 78,368,187 (GRCm39) D287E probably damaging Het
Ino80 A T 2: 119,237,340 (GRCm39) V1123D probably damaging Het
Kdm2b A G 5: 123,122,523 (GRCm39) probably null Het
Kif21a A T 15: 90,856,930 (GRCm39) probably null Het
Klhl33 A T 14: 51,129,583 (GRCm39) N347K probably damaging Het
Krt1c A G 15: 101,724,861 (GRCm39) F250L possibly damaging Het
Krt82 T A 15: 101,451,819 (GRCm39) N332I possibly damaging Het
Lgi1 A G 19: 38,294,631 (GRCm39) I444V probably benign Het
Lmod1 G A 1: 135,252,862 (GRCm39) V39M probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mex3d T C 10: 80,217,376 (GRCm39) T149A probably benign Het
Mideas A G 12: 84,205,748 (GRCm39) probably null Het
Mlxipl A C 5: 135,136,024 (GRCm39) D83A probably damaging Het
Mroh8 T A 2: 157,111,471 (GRCm39) E161V probably benign Het
Mroh9 G A 1: 162,884,347 (GRCm39) T397I probably damaging Het
Mtss1 T C 15: 58,930,249 (GRCm39) D32G possibly damaging Het
Mus81 T C 19: 5,533,504 (GRCm39) D495G probably benign Het
Neurod1 A C 2: 79,284,673 (GRCm39) S237A probably benign Het
Npas1 G A 7: 16,208,725 (GRCm39) R51C probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
P2ry14 T C 3: 59,023,274 (GRCm39) N62S probably damaging Het
Pcdh15 A G 10: 74,460,087 (GRCm39) Y1308C probably damaging Het
Pcdhb14 A T 18: 37,582,588 (GRCm39) M565L probably benign Het
Pde6a A G 18: 61,390,283 (GRCm39) E502G probably damaging Het
Pde8b A G 13: 95,178,527 (GRCm39) V566A probably benign Het
Phf11b G T 14: 59,565,554 (GRCm39) Q108K probably benign Het
Pikfyve T C 1: 65,291,716 (GRCm39) Y1312H probably damaging Het
Plcb3 T C 19: 6,933,381 (GRCm39) probably benign Het
Plxna2 G A 1: 194,488,611 (GRCm39) G1629D probably damaging Het
Plxnb1 T C 9: 108,929,813 (GRCm39) V223A probably benign Het
Prkca A T 11: 107,903,518 (GRCm39) Y285N possibly damaging Het
Prl2a1 A T 13: 27,992,554 (GRCm39) N226I probably damaging Het
Pus7 A C 5: 23,946,914 (GRCm39) M636R probably damaging Het
Sema3d A G 5: 12,634,854 (GRCm39) D640G probably benign Het
Slc6a15 A G 10: 103,236,121 (GRCm39) I279V probably benign Het
Slk T C 19: 47,608,973 (GRCm39) V642A possibly damaging Het
Spata31e2 C A 1: 26,722,070 (GRCm39) G1037* probably null Het
Spta1 T A 1: 174,073,296 (GRCm39) M2305K probably damaging Het
Srrt T C 5: 137,301,274 (GRCm39) probably benign Het
Stfa2l1 A T 16: 35,977,228 (GRCm39) I8L probably benign Het
Tap1 T C 17: 34,413,899 (GRCm39) L638P probably benign Het
Tbccd1 A T 16: 22,640,995 (GRCm39) L461M probably benign Het
Tecta T C 9: 42,289,345 (GRCm39) T407A probably benign Het
Tmbim7 T C 5: 3,707,493 (GRCm39) probably null Het
Tnrc18 C A 5: 142,800,869 (GRCm39) V30L probably benign Het
Tomm7 A G 5: 24,049,025 (GRCm39) F16S probably damaging Het
Ugt2a2 A G 5: 87,622,315 (GRCm39) S428P probably benign Het
Vmn1r189 T C 13: 22,286,324 (GRCm39) E171G probably benign Het
Vmn1r61 T C 7: 5,614,324 (GRCm39) probably benign Het
Vmn2r120 A T 17: 57,832,038 (GRCm39) S250R probably benign Het
Vmn2r8 T C 5: 108,950,972 (GRCm39) R158G probably benign Het
Vmn2r98 A T 17: 19,286,702 (GRCm39) Y400F probably damaging Het
Vps13c C A 9: 67,801,267 (GRCm39) Y582* probably null Het
Zfp518a T A 19: 40,904,000 (GRCm39) F1310I probably benign Het
Zswim1 A G 2: 164,667,320 (GRCm39) I191V probably benign Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3,376,779 (GRCm39) missense probably damaging 0.96
IGL00550:Samd9l APN 6 3,374,594 (GRCm39) missense probably benign 0.00
IGL01100:Samd9l APN 6 3,375,863 (GRCm39) missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3,376,259 (GRCm39) missense probably benign 0.42
IGL01553:Samd9l APN 6 3,375,566 (GRCm39) missense probably damaging 0.99
IGL01575:Samd9l APN 6 3,376,734 (GRCm39) missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3,375,120 (GRCm39) missense probably benign 0.02
IGL01915:Samd9l APN 6 3,373,864 (GRCm39) nonsense probably null
IGL02063:Samd9l APN 6 3,372,992 (GRCm39) missense probably damaging 1.00
IGL02066:Samd9l APN 6 3,376,575 (GRCm39) missense probably damaging 1.00
IGL02145:Samd9l APN 6 3,374,105 (GRCm39) missense probably benign 0.13
IGL02163:Samd9l APN 6 3,374,246 (GRCm39) missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3,376,197 (GRCm39) missense probably damaging 1.00
IGL02508:Samd9l APN 6 3,374,798 (GRCm39) missense probably damaging 1.00
IGL02591:Samd9l APN 6 3,375,760 (GRCm39) missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3,376,026 (GRCm39) missense probably damaging 1.00
IGL03058:Samd9l APN 6 3,374,980 (GRCm39) missense probably damaging 0.99
IGL03068:Samd9l APN 6 3,375,348 (GRCm39) nonsense probably null
IGL03160:Samd9l APN 6 3,374,894 (GRCm39) missense probably damaging 1.00
IGL03372:Samd9l APN 6 3,375,314 (GRCm39) missense probably damaging 1.00
IGL03385:Samd9l APN 6 3,376,208 (GRCm39) missense probably damaging 0.99
boston_lager UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
ipa UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
Paine UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
samad UTSW 6 3,374,032 (GRCm39) nonsense probably null
IGL03054:Samd9l UTSW 6 3,376,023 (GRCm39) missense probably damaging 1.00
R0111:Samd9l UTSW 6 3,374,946 (GRCm39) missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3,376,031 (GRCm39) missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3,377,264 (GRCm39) start gained probably benign
R0398:Samd9l UTSW 6 3,374,502 (GRCm39) missense probably damaging 1.00
R0744:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R1110:Samd9l UTSW 6 3,374,267 (GRCm39) missense probably benign 0.44
R1155:Samd9l UTSW 6 3,376,939 (GRCm39) missense probably benign 0.01
R1268:Samd9l UTSW 6 3,376,113 (GRCm39) missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3,373,947 (GRCm39) missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3,376,369 (GRCm39) missense probably benign 0.06
R1573:Samd9l UTSW 6 3,375,426 (GRCm39) missense probably damaging 0.99
R1590:Samd9l UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
R1611:Samd9l UTSW 6 3,373,771 (GRCm39) missense probably benign 0.00
R1754:Samd9l UTSW 6 3,373,126 (GRCm39) missense probably damaging 0.96
R1759:Samd9l UTSW 6 3,373,401 (GRCm39) missense probably damaging 1.00
R1829:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3,376,269 (GRCm39) missense probably benign 0.01
R2154:Samd9l UTSW 6 3,372,945 (GRCm39) missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3,376,910 (GRCm39) missense probably benign 0.08
R3622:Samd9l UTSW 6 3,374,032 (GRCm39) nonsense probably null
R3903:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3904:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3945:Samd9l UTSW 6 3,377,029 (GRCm39) missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3,376,887 (GRCm39) missense probably benign 0.22
R4602:Samd9l UTSW 6 3,373,937 (GRCm39) frame shift probably null
R4602:Samd9l UTSW 6 3,373,935 (GRCm39) missense probably damaging 1.00
R4618:Samd9l UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
R4747:Samd9l UTSW 6 3,375,504 (GRCm39) nonsense probably null
R4762:Samd9l UTSW 6 3,375,623 (GRCm39) missense probably benign 0.01
R4814:Samd9l UTSW 6 3,372,863 (GRCm39) missense probably damaging 0.98
R4934:Samd9l UTSW 6 3,375,621 (GRCm39) nonsense probably null
R5026:Samd9l UTSW 6 3,375,284 (GRCm39) missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R5130:Samd9l UTSW 6 3,374,548 (GRCm39) missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3,376,156 (GRCm39) missense probably benign 0.02
R5328:Samd9l UTSW 6 3,376,739 (GRCm39) missense probably damaging 0.99
R5507:Samd9l UTSW 6 3,373,898 (GRCm39) missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3,373,291 (GRCm39) missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R5881:Samd9l UTSW 6 3,372,716 (GRCm39) missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3,376,460 (GRCm39) missense probably damaging 1.00
R6131:Samd9l UTSW 6 3,377,252 (GRCm39) missense probably benign 0.00
R6199:Samd9l UTSW 6 3,376,686 (GRCm39) missense probably benign 0.13
R6298:Samd9l UTSW 6 3,375,383 (GRCm39) missense probably damaging 1.00
R6331:Samd9l UTSW 6 3,376,361 (GRCm39) missense probably damaging 1.00
R6489:Samd9l UTSW 6 3,376,896 (GRCm39) missense probably benign
R6601:Samd9l UTSW 6 3,377,229 (GRCm39) missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3,377,247 (GRCm39) missense probably benign 0.22
R6803:Samd9l UTSW 6 3,375,446 (GRCm39) missense probably damaging 0.97
R6864:Samd9l UTSW 6 3,374,750 (GRCm39) missense probably benign 0.14
R6905:Samd9l UTSW 6 3,375,387 (GRCm39) missense probably damaging 0.99
R6919:Samd9l UTSW 6 3,376,313 (GRCm39) missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
R7073:Samd9l UTSW 6 3,375,856 (GRCm39) nonsense probably null
R7250:Samd9l UTSW 6 3,374,201 (GRCm39) missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3,372,600 (GRCm39) nonsense probably null
R7351:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R7423:Samd9l UTSW 6 3,374,408 (GRCm39) missense probably damaging 1.00
R7610:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R7667:Samd9l UTSW 6 3,375,975 (GRCm39) missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3,373,646 (GRCm39) missense probably benign 0.16
R7680:Samd9l UTSW 6 3,376,469 (GRCm39) missense probably damaging 1.00
R7680:Samd9l UTSW 6 3,372,569 (GRCm39) missense probably damaging 1.00
R7814:Samd9l UTSW 6 3,374,793 (GRCm39) missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3,374,749 (GRCm39) missense probably benign 0.00
R8000:Samd9l UTSW 6 3,373,034 (GRCm39) missense probably damaging 1.00
R8098:Samd9l UTSW 6 3,375,549 (GRCm39) missense probably damaging 1.00
R8698:Samd9l UTSW 6 3,373,843 (GRCm39) missense probably benign 0.06
R8785:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R8795:Samd9l UTSW 6 3,374,221 (GRCm39) nonsense probably null
R8806:Samd9l UTSW 6 3,376,665 (GRCm39) missense probably damaging 0.99
R8832:Samd9l UTSW 6 3,374,990 (GRCm39) missense probably damaging 1.00
R8954:Samd9l UTSW 6 3,374,577 (GRCm39) missense probably damaging 0.98
R9023:Samd9l UTSW 6 3,373,791 (GRCm39) missense probably damaging 1.00
R9051:Samd9l UTSW 6 3,373,493 (GRCm39) missense probably benign 0.16
R9108:Samd9l UTSW 6 3,373,104 (GRCm39) missense possibly damaging 0.71
R9213:Samd9l UTSW 6 3,376,856 (GRCm39) missense probably benign 0.23
R9494:Samd9l UTSW 6 3,375,830 (GRCm39) missense possibly damaging 0.51
R9504:Samd9l UTSW 6 3,372,621 (GRCm39) missense probably benign 0.17
R9655:Samd9l UTSW 6 3,373,578 (GRCm39) missense probably benign 0.00
R9688:Samd9l UTSW 6 3,377,087 (GRCm39) missense probably damaging 1.00
R9696:Samd9l UTSW 6 3,375,078 (GRCm39) missense possibly damaging 0.76
R9721:Samd9l UTSW 6 3,375,854 (GRCm39) missense possibly damaging 0.69
X0026:Samd9l UTSW 6 3,375,560 (GRCm39) missense probably damaging 1.00
X0066:Samd9l UTSW 6 3,374,477 (GRCm39) missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3,376,770 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTTGACAAACACTGGTTTAGG -3'
(R):5'- TCTGGCAAAACATAGCATTTCCAC -3'

Sequencing Primer
(F):5'- ACTGGTTTAGGAGAGTCTGCACAC -3'
(R):5'- TAGAACTAGTCAACAATACCATCCTC -3'
Posted On 2014-06-23