Incidental Mutation 'R0091:Chst4'
ID20213
Institutional Source Beutler Lab
Gene Symbol Chst4
Ensembl Gene ENSMUSG00000035930
Gene Namecarbohydrate (chondroitin 6/keratan) sulfotransferase 4
SynonymsGST-3, HEC-GlcNAc6ST, high endothelial cell GlcNAC-6-sulphotransferase
MMRRC Submission 038378-MU
Accession Numbers

Genbank: NM_011998;  MGI: 1349479

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0091 (G1)
Quality Score205
Status Validated (trace)
Chromosome8
Chromosomal Location110029153-110039740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110030665 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 189 (S189G)
Ref Sequence ENSEMBL: ENSMUSP00000148741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109222] [ENSMUST00000211894] [ENSMUST00000212934]
Predicted Effect probably damaging
Transcript: ENSMUST00000109222
AA Change: S106G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104845
Gene: ENSMUSG00000035930
AA Change: S106G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Sulfotransfer_3 41 296 6.4e-15 PFAM
Pfam:Sulfotransfer_1 41 357 2.4e-26 PFAM
low complexity region 370 378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211894
AA Change: S189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212934
AA Change: S106G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.3921 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene do not accumulate lymphocytes in peripheral lymph nodes to as great an extent as normal. The animals are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Chst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Chst4 APN 8 110029965 missense probably benign 0.14
A4554:Chst4 UTSW 8 110029888 missense probably benign 0.09
R0373:Chst4 UTSW 8 110030394 missense probably damaging 1.00
R1171:Chst4 UTSW 8 110030623 missense probably damaging 1.00
R1577:Chst4 UTSW 8 110029844 missense probably benign 0.00
R2377:Chst4 UTSW 8 110030172 missense possibly damaging 0.80
R3421:Chst4 UTSW 8 110030406 missense probably damaging 1.00
R5514:Chst4 UTSW 8 110029974 missense probably damaging 1.00
R6793:Chst4 UTSW 8 110030067 missense probably damaging 1.00
R7141:Chst4 UTSW 8 110030839 missense probably damaging 1.00
R7146:Chst4 UTSW 8 110030731 missense probably damaging 1.00
R7183:Chst4 UTSW 8 110029998 missense possibly damaging 0.72
R7732:Chst4 UTSW 8 110029882 nonsense probably null
R7871:Chst4 UTSW 8 110030913 missense probably damaging 1.00
R8493:Chst4 UTSW 8 110030463 missense probably damaging 1.00
Z1176:Chst4 UTSW 8 110030092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCATATCAAAGGGCTGCTGAC -3'
(R):5'- AAAGGGAGGCTGCTGATGTTCCTG -3'

Sequencing Primer
(F):5'- TGACCGCAGAGCAGCTTG -3'
(R):5'- TTTCCCAGAGGGAGGAGTC -3'
Posted On2013-04-11