Mutagenetix > Incidental Mutation

Incidental Mutation 'R1795:Vps13c'

202139

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

039825-MU

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1795 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 67893985 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 582 (Y582*)

Ref Sequence

ENSEMBL: ENSMUSP00000150974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000077879
AA Change: Y582*

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: Y582*

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000217386
AA Change: Y582*

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,682,989	G1037*	probably null	Het
Abca8a	A	G	11: 110,050,966	I1159T	probably benign	Het
Abcc1	T	C	16: 14,465,137	V1159A	possibly damaging	Het
Abcg5	A	G	17: 84,673,579	I194T	probably damaging	Het
Abtb2	A	G	2: 103,567,024	T100A	probably benign	Het
Adam4	C	T	12: 81,421,294	M184I	probably benign	Het
Afap1l2	T	C	19: 56,928,409	D155G	probably damaging	Het
Ahnak	T	C	19: 9,002,438	V362A	possibly damaging	Het
Ak7	C	T	12: 105,726,223	R179*	probably null	Het
Akap8	C	A	17: 32,315,477	G332C	probably damaging	Het
Akr1e1	T	A	13: 4,595,072	Q204L	probably damaging	Het
Ankrd12	T	C	17: 65,986,227	E737G	possibly damaging	Het
Atrn	A	G	2: 130,972,288	D718G	probably benign	Het
Bco2	A	G	9: 50,541,169	S200P	possibly damaging	Het
C030005K15Rik	A	T	10: 97,725,786	S28T	unknown	Het
Cdc14a	T	A	3: 116,298,473	Q356L	possibly damaging	Het
Cdk5rap3	A	G	11: 96,908,828	L387P	probably damaging	Het
Celsr1	A	T	15: 86,030,323	S1150T	probably damaging	Het
Cntfr	A	G	4: 41,670,841		probably null	Het
Cramp1l	T	C	17: 24,964,910	N1244D	probably damaging	Het
Csmd3	G	T	15: 47,857,920	D1542E	possibly damaging	Het
Cyp4f17	A	T	17: 32,517,969	I92F	probably benign	Het
Dhx30	A	T	9: 110,107,983		probably null	Het
Dlg1	T	A	16: 31,743,147	H120Q	probably benign	Het
Dmgdh	A	T	13: 93,706,699	M348L	probably benign	Het
Dnmt3b	G	A	2: 153,683,639	E741K	possibly damaging	Het
Dock3	T	G	9: 107,025,335	H292P	probably damaging	Het
Elmsan1	A	G	12: 84,158,974		probably null	Het
Ercc6	T	A	14: 32,517,028	N24K	probably benign	Het
Esco2	T	C	14: 65,827,277	Q338R	probably benign	Het
Etl4	T	C	2: 20,808,026		probably null	Het
Exoc7	A	T	11: 116,292,521	I498N	probably damaging	Het
Fap	G	A	2: 62,548,589	S123L	probably damaging	Het
Foxn1	T	C	11: 78,371,225	E106G	probably benign	Het
Fscb	T	A	12: 64,474,401	D97V	probably damaging	Het
Gabrg1	T	C	5: 70,782,253	T174A	possibly damaging	Het
Gan	C	T	8: 117,196,460	A461V	possibly damaging	Het
Gbp2	T	A	3: 142,630,523	D211E	possibly damaging	Het
Gm10271	A	T	10: 116,956,841	Y47N	unknown	Het
Gm17333	G	T	16: 77,852,823		noncoding transcript	Het
Gm1758	T	A	16: 14,502,278		noncoding transcript	Het
Golga3	A	G	5: 110,207,627	K989R	possibly damaging	Het
Gucy2g	C	A	19: 55,199,541	V1041F	probably damaging	Het
Guk1	A	T	11: 59,186,813	F25I	probably benign	Het
H2al1o	C	T	X: 9,572,090	E87K	possibly damaging	Het
Hemgn	C	A	4: 46,395,958	C426F	probably damaging	Het
Hps3	A	G	3: 20,012,695		probably null	Het
Il2rb	A	T	15: 78,483,987	D287E	probably damaging	Het
Ino80	A	T	2: 119,406,859	V1123D	probably damaging	Het
Kdm2b	A	G	5: 122,984,460		probably null	Het
Kif21a	A	T	15: 90,972,727		probably null	Het
Klhl33	A	T	14: 50,892,126	N347K	probably damaging	Het
Krt2	A	G	15: 101,816,426	F250L	possibly damaging	Het
Krt82	T	A	15: 101,543,384	N332I	possibly damaging	Het
Lgi1	A	G	19: 38,306,183	I444V	probably benign	Het
Lmod1	G	A	1: 135,325,124	V39M	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mex3d	T	C	10: 80,381,542	T149A	probably benign	Het
Mlxipl	A	C	5: 135,107,170	D83A	probably damaging	Het
Mroh8	T	A	2: 157,269,551	E161V	probably benign	Het
Mroh9	G	A	1: 163,056,778	T397I	probably damaging	Het
Mtss1	T	C	15: 59,058,400	D32G	possibly damaging	Het
Mus81	T	C	19: 5,483,476	D495G	probably benign	Het
Neurod1	A	C	2: 79,454,329	S237A	probably benign	Het
Npas1	G	A	7: 16,474,800	R51C	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
P2ry14	T	C	3: 59,115,853	N62S	probably damaging	Het
Pcdh15	A	G	10: 74,624,255	Y1308C	probably damaging	Het
Pcdhb14	A	T	18: 37,449,535	M565L	probably benign	Het
Pde6a	A	G	18: 61,257,212	E502G	probably damaging	Het
Pde8b	A	G	13: 95,042,019	V566A	probably benign	Het
Phf11b	G	T	14: 59,328,105	Q108K	probably benign	Het
Pikfyve	T	C	1: 65,252,557	Y1312H	probably damaging	Het
Plcb3	T	C	19: 6,956,013		probably benign	Het
Plxna2	G	A	1: 194,806,303	G1629D	probably damaging	Het
Plxnb1	T	C	9: 109,100,745	V223A	probably benign	Het
Prkca	A	T	11: 108,012,692	Y285N	possibly damaging	Het
Prl2a1	A	T	13: 27,808,571	N226I	probably damaging	Het
Pus7	A	C	5: 23,741,916	M636R	probably damaging	Het
Samd9l	G	A	6: 3,375,264	Q666*	probably null	Het
Sema3d	A	G	5: 12,584,887	D640G	probably benign	Het
Slc6a15	A	G	10: 103,400,260	I279V	probably benign	Het
Slk	T	C	19: 47,620,534	V642A	possibly damaging	Het
Spta1	T	A	1: 174,245,730	M2305K	probably damaging	Het
Srrt	T	C	5: 137,303,012		probably benign	Het
Stfa2l1	A	T	16: 36,156,858	I8L	probably benign	Het
Tap1	T	C	17: 34,194,925	L638P	probably benign	Het
Tbccd1	A	T	16: 22,822,245	L461M	probably benign	Het
Tecta	T	C	9: 42,378,049	T407A	probably benign	Het
Tmbim7	T	C	5: 3,657,493		probably null	Het
Tnrc18	C	A	5: 142,815,114	V30L	probably benign	Het
Tomm7	A	G	5: 23,844,027	F16S	probably damaging	Het
Ugt2a2	A	G	5: 87,474,456	S428P	probably benign	Het
Vmn1r189	T	C	13: 22,102,154	E171G	probably benign	Het
Vmn1r61	T	C	7: 5,611,325		probably benign	Het
Vmn2r120	A	T	17: 57,525,038	S250R	probably benign	Het
Vmn2r8	T	C	5: 108,803,106	R158G	probably benign	Het
Vmn2r98	A	T	17: 19,066,440	Y400F	probably damaging	Het
Zfp518a	T	A	19: 40,915,556	F1310I	probably benign	Het
Zswim1	A	G	2: 164,825,400	I191V	probably benign	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
Derivative	UTSW	9	67930622	missense	possibly damaging	0.79
diversion	UTSW	9	67910233	missense	possibly damaging	0.93
introversion	UTSW	9	67944046	missense	probably damaging	0.98
Inversion	UTSW	9	67902839	critical splice acceptor site	probably null
subversion	UTSW	9	67908052	missense	probably damaging	1.00
Transversion	UTSW	9	67934501	missense	probably damaging	0.98
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0667:Vps13c	UTSW	9	67951573	nonsense	probably null
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1835:Vps13c	UTSW	9	67993013	missense	probably benign	0.08
R1848:Vps13c	UTSW	9	67936340	missense	probably benign
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1945:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5893:Vps13c	UTSW	9	67902839	critical splice acceptor site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7352:Vps13c	UTSW	9	67840446	missense	possibly damaging	0.94
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7516:Vps13c	UTSW	9	67955007	missense	possibly damaging	0.89
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
R8734:Vps13c	UTSW	9	67973403	missense	probably damaging	1.00
R8806:Vps13c	UTSW	9	67945828	missense	probably damaging	1.00
R8807:Vps13c	UTSW	9	67858840	missense	probably damaging	0.99
R8813:Vps13c	UTSW	9	67871284	missense	probably damaging	1.00
R8883:Vps13c	UTSW	9	67948197	missense	probably benign	0.10
R8885:Vps13c	UTSW	9	67943454	missense	probably benign
R8899:Vps13c	UTSW	9	67934501	missense	probably damaging	0.98
R8970:Vps13c	UTSW	9	67945521	missense	probably benign	0.11
R9007:Vps13c	UTSW	9	67937724	missense	probably benign	0.00
R9026:Vps13c	UTSW	9	67954581	missense	probably damaging	1.00
R9029:Vps13c	UTSW	9	67948147	missense	probably damaging	0.98
R9057:Vps13c	UTSW	9	67920927	missense	probably benign	0.00
R9105:Vps13c	UTSW	9	67870799	intron	probably benign
R9130:Vps13c	UTSW	9	67929523	missense	probably damaging	1.00
R9286:Vps13c	UTSW	9	67972921	missense	probably benign	0.00
R9338:Vps13c	UTSW	9	67951695	missense	probably damaging	1.00
R9432:Vps13c	UTSW	9	67922855	missense	probably benign	0.02
R9460:Vps13c	UTSW	9	67930622	missense	possibly damaging	0.79
R9464:Vps13c	UTSW	9	67951392	missense	probably damaging	1.00
R9561:Vps13c	UTSW	9	67965512	missense	probably damaging	1.00
R9609:Vps13c	UTSW	9	67934549	missense	probably damaging	1.00
R9622:Vps13c	UTSW	9	67949433	missense	probably damaging	1.00
R9665:Vps13c	UTSW	9	67955743	nonsense	probably null
R9731:Vps13c	UTSW	9	67919244	missense	probably benign
R9763:Vps13c	UTSW	9	67911578	missense	probably benign	0.00
R9774:Vps13c	UTSW	9	67884591	missense	possibly damaging	0.85
R9798:Vps13c	UTSW	9	67919364	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCGTTTCCTGTGGATGATAAATAG -3'
(R):5'- TTCTGCCTGCACTTACAGCG -3'

Sequencing Primer
(F):5'- TAGCTAAGGAGACACTGACTCTC -3'
(R):5'- CTGCACTTACAGCGTCATAGATG -3'

Posted On

2014-06-23