Incidental Mutation 'R1795:Vps13c'
ID202139
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission 039825-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1795 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 67893985 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 582 (Y582*)
Ref Sequence ENSEMBL: ENSMUSP00000150974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]
Predicted Effect probably null
Transcript: ENSMUST00000077879
AA Change: Y582*
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: Y582*

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217386
AA Change: Y582*
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,682,989 G1037* probably null Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Abcg5 A G 17: 84,673,579 I194T probably damaging Het
Abtb2 A G 2: 103,567,024 T100A probably benign Het
Adam4 C T 12: 81,421,294 M184I probably benign Het
Afap1l2 T C 19: 56,928,409 D155G probably damaging Het
Ahnak T C 19: 9,002,438 V362A possibly damaging Het
Ak7 C T 12: 105,726,223 R179* probably null Het
Akap8 C A 17: 32,315,477 G332C probably damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Ankrd12 T C 17: 65,986,227 E737G possibly damaging Het
Atrn A G 2: 130,972,288 D718G probably benign Het
Bco2 A G 9: 50,541,169 S200P possibly damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdc14a T A 3: 116,298,473 Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Celsr1 A T 15: 86,030,323 S1150T probably damaging Het
Cntfr A G 4: 41,670,841 probably null Het
Cramp1l T C 17: 24,964,910 N1244D probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Cyp4f17 A T 17: 32,517,969 I92F probably benign Het
Dhx30 A T 9: 110,107,983 probably null Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dmgdh A T 13: 93,706,699 M348L probably benign Het
Dnmt3b G A 2: 153,683,639 E741K possibly damaging Het
Dock3 T G 9: 107,025,335 H292P probably damaging Het
Elmsan1 A G 12: 84,158,974 probably null Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Etl4 T C 2: 20,808,026 probably null Het
Exoc7 A T 11: 116,292,521 I498N probably damaging Het
Fap G A 2: 62,548,589 S123L probably damaging Het
Foxn1 T C 11: 78,371,225 E106G probably benign Het
Fscb T A 12: 64,474,401 D97V probably damaging Het
Gabrg1 T C 5: 70,782,253 T174A possibly damaging Het
Gan C T 8: 117,196,460 A461V possibly damaging Het
Gbp2 T A 3: 142,630,523 D211E possibly damaging Het
Gm10271 A T 10: 116,956,841 Y47N unknown Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm1758 T A 16: 14,502,278 noncoding transcript Het
Golga3 A G 5: 110,207,627 K989R possibly damaging Het
Gucy2g C A 19: 55,199,541 V1041F probably damaging Het
Guk1 A T 11: 59,186,813 F25I probably benign Het
H2al1o C T X: 9,572,090 E87K possibly damaging Het
Hemgn C A 4: 46,395,958 C426F probably damaging Het
Hps3 A G 3: 20,012,695 probably null Het
Il2rb A T 15: 78,483,987 D287E probably damaging Het
Ino80 A T 2: 119,406,859 V1123D probably damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif21a A T 15: 90,972,727 probably null Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Krt2 A G 15: 101,816,426 F250L possibly damaging Het
Krt82 T A 15: 101,543,384 N332I possibly damaging Het
Lgi1 A G 19: 38,306,183 I444V probably benign Het
Lmod1 G A 1: 135,325,124 V39M probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Mlxipl A C 5: 135,107,170 D83A probably damaging Het
Mroh8 T A 2: 157,269,551 E161V probably benign Het
Mroh9 G A 1: 163,056,778 T397I probably damaging Het
Mtss1 T C 15: 59,058,400 D32G possibly damaging Het
Mus81 T C 19: 5,483,476 D495G probably benign Het
Neurod1 A C 2: 79,454,329 S237A probably benign Het
Npas1 G A 7: 16,474,800 R51C probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
P2ry14 T C 3: 59,115,853 N62S probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcdhb14 A T 18: 37,449,535 M565L probably benign Het
Pde6a A G 18: 61,257,212 E502G probably damaging Het
Pde8b A G 13: 95,042,019 V566A probably benign Het
Phf11b G T 14: 59,328,105 Q108K probably benign Het
Pikfyve T C 1: 65,252,557 Y1312H probably damaging Het
Plcb3 T C 19: 6,956,013 probably benign Het
Plxna2 G A 1: 194,806,303 G1629D probably damaging Het
Plxnb1 T C 9: 109,100,745 V223A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Prl2a1 A T 13: 27,808,571 N226I probably damaging Het
Pus7 A C 5: 23,741,916 M636R probably damaging Het
Samd9l G A 6: 3,375,264 Q666* probably null Het
Sema3d A G 5: 12,584,887 D640G probably benign Het
Slc6a15 A G 10: 103,400,260 I279V probably benign Het
Slk T C 19: 47,620,534 V642A possibly damaging Het
Spta1 T A 1: 174,245,730 M2305K probably damaging Het
Srrt T C 5: 137,303,012 probably benign Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Tap1 T C 17: 34,194,925 L638P probably benign Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tecta T C 9: 42,378,049 T407A probably benign Het
Tmbim7 T C 5: 3,657,493 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ugt2a2 A G 5: 87,474,456 S428P probably benign Het
Vmn1r189 T C 13: 22,102,154 E171G probably benign Het
Vmn1r61 T C 7: 5,611,325 probably benign Het
Vmn2r120 A T 17: 57,525,038 S250R probably benign Het
Vmn2r8 T C 5: 108,803,106 R158G probably benign Het
Vmn2r98 A T 17: 19,066,440 Y400F probably damaging Het
Zfp518a T A 19: 40,915,556 F1310I probably benign Het
Zswim1 A G 2: 164,825,400 I191V probably benign Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGTTTCCTGTGGATGATAAATAG -3'
(R):5'- TTCTGCCTGCACTTACAGCG -3'

Sequencing Primer
(F):5'- TAGCTAAGGAGACACTGACTCTC -3'
(R):5'- CTGCACTTACAGCGTCATAGATG -3'
Posted On2014-06-23