Incidental Mutation 'R1795:Adam4'
ID202159
Institutional Source Beutler Lab
Gene Symbol Adam4
Ensembl Gene ENSMUSG00000072972
Gene Namea disintegrin and metallopeptidase domain 4
SynonymstMDCV
MMRRC Submission 039825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1795 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81419443-81421946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81421294 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 184 (M184I)
Ref Sequence ENSEMBL: ENSMUSP00000082427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085319] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000085319
AA Change: M184I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082427
Gene: ENSMUSG00000072972
AA Change: M184I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 9e-19 PFAM
Pfam:Reprolysin 213 406 1.3e-16 PFAM
DISIN 429 504 4.89e-37 SMART
ACR 505 648 2.28e-57 SMART
transmembrane domain 718 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,682,989 G1037* probably null Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Abcg5 A G 17: 84,673,579 I194T probably damaging Het
Abtb2 A G 2: 103,567,024 T100A probably benign Het
Afap1l2 T C 19: 56,928,409 D155G probably damaging Het
Ahnak T C 19: 9,002,438 V362A possibly damaging Het
Ak7 C T 12: 105,726,223 R179* probably null Het
Akap8 C A 17: 32,315,477 G332C probably damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Ankrd12 T C 17: 65,986,227 E737G possibly damaging Het
Atrn A G 2: 130,972,288 D718G probably benign Het
Bco2 A G 9: 50,541,169 S200P possibly damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdc14a T A 3: 116,298,473 Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Celsr1 A T 15: 86,030,323 S1150T probably damaging Het
Cntfr A G 4: 41,670,841 probably null Het
Cramp1l T C 17: 24,964,910 N1244D probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Cyp4f17 A T 17: 32,517,969 I92F probably benign Het
Dhx30 A T 9: 110,107,983 probably null Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dmgdh A T 13: 93,706,699 M348L probably benign Het
Dnmt3b G A 2: 153,683,639 E741K possibly damaging Het
Dock3 T G 9: 107,025,335 H292P probably damaging Het
Elmsan1 A G 12: 84,158,974 probably null Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Etl4 T C 2: 20,808,026 probably null Het
Exoc7 A T 11: 116,292,521 I498N probably damaging Het
Fap G A 2: 62,548,589 S123L probably damaging Het
Foxn1 T C 11: 78,371,225 E106G probably benign Het
Fscb T A 12: 64,474,401 D97V probably damaging Het
Gabrg1 T C 5: 70,782,253 T174A possibly damaging Het
Gan C T 8: 117,196,460 A461V possibly damaging Het
Gbp2 T A 3: 142,630,523 D211E possibly damaging Het
Gm10271 A T 10: 116,956,841 Y47N unknown Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm1758 T A 16: 14,502,278 noncoding transcript Het
Golga3 A G 5: 110,207,627 K989R possibly damaging Het
Gucy2g C A 19: 55,199,541 V1041F probably damaging Het
Guk1 A T 11: 59,186,813 F25I probably benign Het
H2al1o C T X: 9,572,090 E87K possibly damaging Het
Hemgn C A 4: 46,395,958 C426F probably damaging Het
Hps3 A G 3: 20,012,695 probably null Het
Il2rb A T 15: 78,483,987 D287E probably damaging Het
Ino80 A T 2: 119,406,859 V1123D probably damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif21a A T 15: 90,972,727 probably null Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Krt2 A G 15: 101,816,426 F250L possibly damaging Het
Krt82 T A 15: 101,543,384 N332I possibly damaging Het
Lgi1 A G 19: 38,306,183 I444V probably benign Het
Lmod1 G A 1: 135,325,124 V39M probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Mlxipl A C 5: 135,107,170 D83A probably damaging Het
Mroh8 T A 2: 157,269,551 E161V probably benign Het
Mroh9 G A 1: 163,056,778 T397I probably damaging Het
Mtss1 T C 15: 59,058,400 D32G possibly damaging Het
Mus81 T C 19: 5,483,476 D495G probably benign Het
Neurod1 A C 2: 79,454,329 S237A probably benign Het
Npas1 G A 7: 16,474,800 R51C probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
P2ry14 T C 3: 59,115,853 N62S probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcdhb14 A T 18: 37,449,535 M565L probably benign Het
Pde6a A G 18: 61,257,212 E502G probably damaging Het
Pde8b A G 13: 95,042,019 V566A probably benign Het
Phf11b G T 14: 59,328,105 Q108K probably benign Het
Pikfyve T C 1: 65,252,557 Y1312H probably damaging Het
Plcb3 T C 19: 6,956,013 probably benign Het
Plxna2 G A 1: 194,806,303 G1629D probably damaging Het
Plxnb1 T C 9: 109,100,745 V223A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Prl2a1 A T 13: 27,808,571 N226I probably damaging Het
Pus7 A C 5: 23,741,916 M636R probably damaging Het
Samd9l G A 6: 3,375,264 Q666* probably null Het
Sema3d A G 5: 12,584,887 D640G probably benign Het
Slc6a15 A G 10: 103,400,260 I279V probably benign Het
Slk T C 19: 47,620,534 V642A possibly damaging Het
Spta1 T A 1: 174,245,730 M2305K probably damaging Het
Srrt T C 5: 137,303,012 probably benign Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Tap1 T C 17: 34,194,925 L638P probably benign Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tecta T C 9: 42,378,049 T407A probably benign Het
Tmbim7 T C 5: 3,657,493 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ugt2a2 A G 5: 87,474,456 S428P probably benign Het
Vmn1r189 T C 13: 22,102,154 E171G probably benign Het
Vmn1r61 T C 7: 5,611,325 probably benign Het
Vmn2r120 A T 17: 57,525,038 S250R probably benign Het
Vmn2r8 T C 5: 108,803,106 R158G probably benign Het
Vmn2r98 A T 17: 19,066,440 Y400F probably damaging Het
Vps13c C A 9: 67,893,985 Y582* probably null Het
Zfp518a T A 19: 40,915,556 F1310I probably benign Het
Zswim1 A G 2: 164,825,400 I191V probably benign Het
Other mutations in Adam4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Adam4 APN 12 81420649 missense probably damaging 0.96
IGL01133:Adam4 APN 12 81421446 missense possibly damaging 0.53
IGL01636:Adam4 APN 12 81419949 missense possibly damaging 0.81
IGL02133:Adam4 APN 12 81420029 missense probably benign 0.37
IGL02137:Adam4 APN 12 81421103 missense possibly damaging 0.91
IGL02425:Adam4 APN 12 81421328 missense probably benign 0.07
IGL02686:Adam4 APN 12 81421674 missense possibly damaging 0.88
R0554:Adam4 UTSW 12 81421424 missense probably damaging 1.00
R0684:Adam4 UTSW 12 81419654 missense probably damaging 1.00
R1519:Adam4 UTSW 12 81420877 missense possibly damaging 0.67
R1636:Adam4 UTSW 12 81419690 missense probably damaging 0.98
R1835:Adam4 UTSW 12 81419559 missense probably benign 0.00
R2158:Adam4 UTSW 12 81421763 missense probably damaging 1.00
R2393:Adam4 UTSW 12 81420711 missense probably benign 0.02
R2923:Adam4 UTSW 12 81420744 missense probably damaging 1.00
R3411:Adam4 UTSW 12 81419822 missense possibly damaging 0.64
R4159:Adam4 UTSW 12 81420032 missense probably damaging 0.99
R4509:Adam4 UTSW 12 81421747 nonsense probably null
R4673:Adam4 UTSW 12 81421761 missense possibly damaging 0.56
R4794:Adam4 UTSW 12 81421424 missense probably damaging 0.99
R5564:Adam4 UTSW 12 81419574 missense probably benign 0.00
R5774:Adam4 UTSW 12 81420686 missense probably damaging 1.00
R6054:Adam4 UTSW 12 81420054 missense probably damaging 0.99
R6722:Adam4 UTSW 12 81421454 missense probably damaging 1.00
R6857:Adam4 UTSW 12 81419949 missense possibly damaging 0.81
R7316:Adam4 UTSW 12 81419724 missense probably benign 0.08
R7393:Adam4 UTSW 12 81419660 missense probably benign 0.01
R7649:Adam4 UTSW 12 81420377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTATTAACTCAACTGAGGTGG -3'
(R):5'- GGATTACCCATTTGTTCCTCGG -3'

Sequencing Primer
(F):5'- AGGTGGAGGAATTGCTCCC -3'
(R):5'- ACTTCTACAGCTTCCTGGAAGG -3'
Posted On2014-06-23