Incidental Mutation 'R1795:Celsr1'
ID 202177
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Name cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms Scy, Adgrc1, Crsh, crash
MMRRC Submission 039825-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.625) question?
Stock # R1795 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 85783130-85918404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85914524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1150 (S1150T)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000016172
AA Change: S1150T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: S1150T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,941,792 (GRCm39) I1159T probably benign Het
Abcc1 T C 16: 14,283,001 (GRCm39) V1159A possibly damaging Het
Abcg5 A G 17: 84,981,007 (GRCm39) I194T probably damaging Het
Abtb2 A G 2: 103,397,369 (GRCm39) T100A probably benign Het
Adam4 C T 12: 81,468,068 (GRCm39) M184I probably benign Het
Afap1l2 T C 19: 56,916,841 (GRCm39) D155G probably damaging Het
Ahnak T C 19: 8,979,802 (GRCm39) V362A possibly damaging Het
Ak7 C T 12: 105,692,482 (GRCm39) R179* probably null Het
Akap8 C A 17: 32,534,451 (GRCm39) G332C probably damaging Het
Akr1e1 T A 13: 4,645,071 (GRCm39) Q204L probably damaging Het
Ankrd12 T C 17: 66,293,222 (GRCm39) E737G possibly damaging Het
Atrn A G 2: 130,814,208 (GRCm39) D718G probably benign Het
Bco2 A G 9: 50,452,469 (GRCm39) S200P possibly damaging Het
C030005K15Rik A T 10: 97,561,648 (GRCm39) S28T unknown Het
Cdc14a T A 3: 116,092,122 (GRCm39) Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,799,654 (GRCm39) L387P probably damaging Het
Cntfr A G 4: 41,670,841 (GRCm39) probably null Het
Cramp1 T C 17: 25,183,884 (GRCm39) N1244D probably damaging Het
Csmd3 G T 15: 47,721,316 (GRCm39) D1542E possibly damaging Het
Cyp4f17 A T 17: 32,736,943 (GRCm39) I92F probably benign Het
Dhx30 A T 9: 109,937,051 (GRCm39) probably null Het
Dlg1 T A 16: 31,561,965 (GRCm39) H120Q probably benign Het
Dmgdh A T 13: 93,843,207 (GRCm39) M348L probably benign Het
Dnmt3b G A 2: 153,525,559 (GRCm39) E741K possibly damaging Het
Dock3 T G 9: 106,902,534 (GRCm39) H292P probably damaging Het
Ercc6 T A 14: 32,238,985 (GRCm39) N24K probably benign Het
Esco2 T C 14: 66,064,726 (GRCm39) Q338R probably benign Het
Etl4 T C 2: 20,812,837 (GRCm39) probably null Het
Exoc7 A T 11: 116,183,347 (GRCm39) I498N probably damaging Het
Fap G A 2: 62,378,933 (GRCm39) S123L probably damaging Het
Foxn1 T C 11: 78,262,051 (GRCm39) E106G probably benign Het
Fscb T A 12: 64,521,175 (GRCm39) D97V probably damaging Het
Gabrg1 T C 5: 70,939,596 (GRCm39) T174A possibly damaging Het
Gan C T 8: 117,923,199 (GRCm39) A461V possibly damaging Het
Gbp2 T A 3: 142,336,284 (GRCm39) D211E possibly damaging Het
Gm10271 A T 10: 116,792,746 (GRCm39) Y47N unknown Het
Gm17333 G T 16: 77,649,711 (GRCm39) noncoding transcript Het
Gm1758 T A 16: 14,320,142 (GRCm39) noncoding transcript Het
Golga3 A G 5: 110,355,493 (GRCm39) K989R possibly damaging Het
Gucy2g C A 19: 55,187,973 (GRCm39) V1041F probably damaging Het
Guk1 A T 11: 59,077,639 (GRCm39) F25I probably benign Het
H2al1o C T X: 9,438,329 (GRCm39) E87K possibly damaging Het
Hemgn C A 4: 46,395,958 (GRCm39) C426F probably damaging Het
Hps3 A G 3: 20,066,859 (GRCm39) probably null Het
Il2rb A T 15: 78,368,187 (GRCm39) D287E probably damaging Het
Ino80 A T 2: 119,237,340 (GRCm39) V1123D probably damaging Het
Kdm2b A G 5: 123,122,523 (GRCm39) probably null Het
Kif21a A T 15: 90,856,930 (GRCm39) probably null Het
Klhl33 A T 14: 51,129,583 (GRCm39) N347K probably damaging Het
Krt1c A G 15: 101,724,861 (GRCm39) F250L possibly damaging Het
Krt82 T A 15: 101,451,819 (GRCm39) N332I possibly damaging Het
Lgi1 A G 19: 38,294,631 (GRCm39) I444V probably benign Het
Lmod1 G A 1: 135,252,862 (GRCm39) V39M probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mex3d T C 10: 80,217,376 (GRCm39) T149A probably benign Het
Mideas A G 12: 84,205,748 (GRCm39) probably null Het
Mlxipl A C 5: 135,136,024 (GRCm39) D83A probably damaging Het
Mroh8 T A 2: 157,111,471 (GRCm39) E161V probably benign Het
Mroh9 G A 1: 162,884,347 (GRCm39) T397I probably damaging Het
Mtss1 T C 15: 58,930,249 (GRCm39) D32G possibly damaging Het
Mus81 T C 19: 5,533,504 (GRCm39) D495G probably benign Het
Neurod1 A C 2: 79,284,673 (GRCm39) S237A probably benign Het
Npas1 G A 7: 16,208,725 (GRCm39) R51C probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
P2ry14 T C 3: 59,023,274 (GRCm39) N62S probably damaging Het
Pcdh15 A G 10: 74,460,087 (GRCm39) Y1308C probably damaging Het
Pcdhb14 A T 18: 37,582,588 (GRCm39) M565L probably benign Het
Pde6a A G 18: 61,390,283 (GRCm39) E502G probably damaging Het
Pde8b A G 13: 95,178,527 (GRCm39) V566A probably benign Het
Phf11b G T 14: 59,565,554 (GRCm39) Q108K probably benign Het
Pikfyve T C 1: 65,291,716 (GRCm39) Y1312H probably damaging Het
Plcb3 T C 19: 6,933,381 (GRCm39) probably benign Het
Plxna2 G A 1: 194,488,611 (GRCm39) G1629D probably damaging Het
Plxnb1 T C 9: 108,929,813 (GRCm39) V223A probably benign Het
Prkca A T 11: 107,903,518 (GRCm39) Y285N possibly damaging Het
Prl2a1 A T 13: 27,992,554 (GRCm39) N226I probably damaging Het
Pus7 A C 5: 23,946,914 (GRCm39) M636R probably damaging Het
Samd9l G A 6: 3,375,264 (GRCm39) Q666* probably null Het
Sema3d A G 5: 12,634,854 (GRCm39) D640G probably benign Het
Slc6a15 A G 10: 103,236,121 (GRCm39) I279V probably benign Het
Slk T C 19: 47,608,973 (GRCm39) V642A possibly damaging Het
Spata31e2 C A 1: 26,722,070 (GRCm39) G1037* probably null Het
Spta1 T A 1: 174,073,296 (GRCm39) M2305K probably damaging Het
Srrt T C 5: 137,301,274 (GRCm39) probably benign Het
Stfa2l1 A T 16: 35,977,228 (GRCm39) I8L probably benign Het
Tap1 T C 17: 34,413,899 (GRCm39) L638P probably benign Het
Tbccd1 A T 16: 22,640,995 (GRCm39) L461M probably benign Het
Tecta T C 9: 42,289,345 (GRCm39) T407A probably benign Het
Tmbim7 T C 5: 3,707,493 (GRCm39) probably null Het
Tnrc18 C A 5: 142,800,869 (GRCm39) V30L probably benign Het
Tomm7 A G 5: 24,049,025 (GRCm39) F16S probably damaging Het
Ugt2a2 A G 5: 87,622,315 (GRCm39) S428P probably benign Het
Vmn1r189 T C 13: 22,286,324 (GRCm39) E171G probably benign Het
Vmn1r61 T C 7: 5,614,324 (GRCm39) probably benign Het
Vmn2r120 A T 17: 57,832,038 (GRCm39) S250R probably benign Het
Vmn2r8 T C 5: 108,950,972 (GRCm39) R158G probably benign Het
Vmn2r98 A T 17: 19,286,702 (GRCm39) Y400F probably damaging Het
Vps13c C A 9: 67,801,267 (GRCm39) Y582* probably null Het
Zfp518a T A 19: 40,904,000 (GRCm39) F1310I probably benign Het
Zswim1 A G 2: 164,667,320 (GRCm39) I191V probably benign Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85,815,546 (GRCm39) missense probably benign 0.04
IGL00519:Celsr1 APN 15 85,915,037 (GRCm39) missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85,806,436 (GRCm39) missense probably damaging 1.00
IGL01303:Celsr1 APN 15 85,914,692 (GRCm39) missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85,810,391 (GRCm39) missense probably benign 0.35
IGL01910:Celsr1 APN 15 85,814,096 (GRCm39) missense probably benign
IGL01931:Celsr1 APN 15 85,791,861 (GRCm39) missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85,847,424 (GRCm39) missense probably benign 0.35
IGL02090:Celsr1 APN 15 85,791,922 (GRCm39) missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85,863,205 (GRCm39) missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85,814,108 (GRCm39) missense probably benign 0.01
IGL02413:Celsr1 APN 15 85,915,427 (GRCm39) missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85,825,337 (GRCm39) missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85,784,889 (GRCm39) utr 3 prime probably benign
IGL02508:Celsr1 APN 15 85,914,818 (GRCm39) nonsense probably null
IGL02899:Celsr1 APN 15 85,915,927 (GRCm39) missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85,785,673 (GRCm39) missense probably benign
IGL03212:Celsr1 APN 15 85,814,878 (GRCm39) missense probably benign 0.04
P0028:Celsr1 UTSW 15 85,806,436 (GRCm39) missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85,785,138 (GRCm39) missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 85,916,615 (GRCm39) missense probably damaging 0.99
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85,813,620 (GRCm39) missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 85,914,963 (GRCm39) missense probably benign 0.02
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85,787,065 (GRCm39) missense probably benign 0.00
R0570:Celsr1 UTSW 15 85,787,566 (GRCm39) missense probably benign 0.18
R0611:Celsr1 UTSW 15 85,816,524 (GRCm39) missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85,785,798 (GRCm39) missense probably benign
R0792:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R0943:Celsr1 UTSW 15 85,787,489 (GRCm39) missense probably damaging 1.00
R0989:Celsr1 UTSW 15 85,915,480 (GRCm39) missense probably benign 0.39
R1118:Celsr1 UTSW 15 85,916,248 (GRCm39) missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R1239:Celsr1 UTSW 15 85,863,347 (GRCm39) missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1522:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R1662:Celsr1 UTSW 15 85,915,263 (GRCm39) missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85,816,658 (GRCm39) missense probably benign 0.00
R1799:Celsr1 UTSW 15 85,916,886 (GRCm39) missense probably damaging 1.00
R1858:Celsr1 UTSW 15 85,916,960 (GRCm39) missense probably damaging 1.00
R2040:Celsr1 UTSW 15 85,917,088 (GRCm39) missense probably damaging 1.00
R2050:Celsr1 UTSW 15 85,914,748 (GRCm39) missense probably benign 0.02
R2131:Celsr1 UTSW 15 85,847,424 (GRCm39) missense probably benign 0.35
R2132:Celsr1 UTSW 15 85,916,168 (GRCm39) missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85,863,431 (GRCm39) missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85,800,924 (GRCm39) missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 85,916,008 (GRCm39) missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85,863,028 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,847,334 (GRCm39) missense probably benign 0.00
R4416:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85,800,957 (GRCm39) missense probably benign 0.35
R4666:Celsr1 UTSW 15 85,914,695 (GRCm39) missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85,816,661 (GRCm39) missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85,790,230 (GRCm39) critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85,822,154 (GRCm39) missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85,822,112 (GRCm39) missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85,823,335 (GRCm39) missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85,816,585 (GRCm39) missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85,814,747 (GRCm39) missense probably benign
R5310:Celsr1 UTSW 15 85,810,423 (GRCm39) missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85,815,483 (GRCm39) missense probably benign 0.00
R5639:Celsr1 UTSW 15 85,914,968 (GRCm39) missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85,825,465 (GRCm39) missense probably benign 0.27
R5778:Celsr1 UTSW 15 85,917,156 (GRCm39) missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85,788,215 (GRCm39) missense probably benign 0.02
R5915:Celsr1 UTSW 15 85,914,550 (GRCm39) missense probably damaging 0.96
R5915:Celsr1 UTSW 15 85,822,176 (GRCm39) missense probably benign
R5932:Celsr1 UTSW 15 85,916,905 (GRCm39) missense probably damaging 1.00
R5950:Celsr1 UTSW 15 85,916,701 (GRCm39) missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85,803,239 (GRCm39) splice site probably null
R6050:Celsr1 UTSW 15 85,814,812 (GRCm39) missense probably benign 0.00
R6117:Celsr1 UTSW 15 85,816,612 (GRCm39) missense probably benign 0.04
R6178:Celsr1 UTSW 15 85,785,222 (GRCm39) missense probably benign 0.08
R6186:Celsr1 UTSW 15 85,805,394 (GRCm39) missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85,800,888 (GRCm39) missense probably benign 0.25
R6307:Celsr1 UTSW 15 85,812,531 (GRCm39) missense probably benign
R6320:Celsr1 UTSW 15 85,785,160 (GRCm39) missense probably benign 0.13
R6349:Celsr1 UTSW 15 85,915,885 (GRCm39) missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85,863,121 (GRCm39) missense probably benign 0.07
R6607:Celsr1 UTSW 15 85,847,486 (GRCm39) missense probably benign
R6615:Celsr1 UTSW 15 85,786,315 (GRCm39) critical splice donor site probably null
R6661:Celsr1 UTSW 15 85,803,135 (GRCm39) missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85,790,115 (GRCm39) critical splice donor site probably null
R6743:Celsr1 UTSW 15 85,791,799 (GRCm39) missense probably damaging 0.96
R6746:Celsr1 UTSW 15 85,915,696 (GRCm39) missense probably damaging 1.00
R6772:Celsr1 UTSW 15 85,914,983 (GRCm39) missense probably benign
R6838:Celsr1 UTSW 15 85,823,395 (GRCm39) missense probably benign
R6886:Celsr1 UTSW 15 85,915,855 (GRCm39) missense probably benign 0.00
R7030:Celsr1 UTSW 15 85,789,679 (GRCm39) missense probably damaging 0.99
R7060:Celsr1 UTSW 15 85,916,856 (GRCm39) missense probably benign 0.07
R7080:Celsr1 UTSW 15 85,816,652 (GRCm39) missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 85,917,209 (GRCm39) missense probably damaging 0.99
R7357:Celsr1 UTSW 15 85,914,715 (GRCm39) missense probably benign 0.00
R7371:Celsr1 UTSW 15 85,914,875 (GRCm39) missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85,791,874 (GRCm39) missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 85,917,593 (GRCm39) missense probably benign
R7491:Celsr1 UTSW 15 85,916,719 (GRCm39) missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85,814,073 (GRCm39) missense probably benign 0.00
R7685:Celsr1 UTSW 15 85,862,933 (GRCm39) nonsense probably null
R7741:Celsr1 UTSW 15 85,863,303 (GRCm39) missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85,816,610 (GRCm39) missense probably benign
R7974:Celsr1 UTSW 15 85,915,231 (GRCm39) missense probably damaging 1.00
R7977:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R7987:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85,823,356 (GRCm39) missense probably benign 0.00
R8099:Celsr1 UTSW 15 85,915,801 (GRCm39) missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85,787,090 (GRCm39) missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85,863,436 (GRCm39) missense probably benign 0.00
R8289:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8290:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8292:Celsr1 UTSW 15 85,791,819 (GRCm39) missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85,806,445 (GRCm39) missense probably benign 0.00
R8330:Celsr1 UTSW 15 85,816,501 (GRCm39) missense probably damaging 0.99
R8333:Celsr1 UTSW 15 85,915,615 (GRCm39) missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8452:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8463:Celsr1 UTSW 15 85,914,415 (GRCm39) missense probably damaging 1.00
R8479:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8480:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8493:Celsr1 UTSW 15 85,822,207 (GRCm39) missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85,823,306 (GRCm39) missense probably benign 0.01
R8506:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8771:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R8891:Celsr1 UTSW 15 85,822,194 (GRCm39) missense probably benign 0.01
R8905:Celsr1 UTSW 15 85,788,269 (GRCm39) intron probably benign
R8924:Celsr1 UTSW 15 85,916,671 (GRCm39) missense possibly damaging 0.94
R8979:Celsr1 UTSW 15 85,847,340 (GRCm39) missense probably damaging 0.96
R9069:Celsr1 UTSW 15 85,914,772 (GRCm39) missense possibly damaging 0.53
R9115:Celsr1 UTSW 15 85,803,217 (GRCm39) missense probably damaging 1.00
R9194:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9196:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9198:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9200:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9201:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9202:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9203:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9222:Celsr1 UTSW 15 85,815,471 (GRCm39) missense possibly damaging 0.68
R9236:Celsr1 UTSW 15 85,915,051 (GRCm39) missense probably damaging 1.00
R9384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9386:Celsr1 UTSW 15 85,863,231 (GRCm39) missense probably damaging 1.00
R9400:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9401:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9415:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9428:Celsr1 UTSW 15 85,815,549 (GRCm39) missense possibly damaging 0.64
R9435:Celsr1 UTSW 15 85,806,535 (GRCm39) splice site probably benign
R9493:Celsr1 UTSW 15 85,785,346 (GRCm39) missense probably damaging 0.98
R9495:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9499:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9607:Celsr1 UTSW 15 85,915,229 (GRCm39) missense
R9673:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
Z1176:Celsr1 UTSW 15 85,847,301 (GRCm39) missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85,863,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGTCTAAGCATGCCCAGG -3'
(R):5'- ACGTCTGCTCCTCTGGTAAG -3'

Sequencing Primer
(F):5'- AGGTTCTCTGGGAGTCCC -3'
(R):5'- TCCTCTGGTAAGCCGGG -3'
Posted On 2014-06-23