Mutagenetix > Incidental Mutation

Incidental Mutation 'R1795:Pde6a'

202197

Institutional Source

Beutler Lab

Gene Symbol

Pde6a

Ensembl Gene

ENSMUSG00000024575

Gene Name

phosphodiesterase 6A, cGMP-specific, rod, alpha

Synonyms

Pdea

MMRRC Submission

039825-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1795 (G1)

Quality Score

216

Status

Not validated

Chromosome

Chromosomal Location

61220482-61289924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61257212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 502 (E502G)

Ref Sequence

ENSEMBL: ENSMUSP00000025468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025468]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025468
AA Change: E502G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: E502G

Domain	Start	End	E-Value	Type
GAF	73	232	1.36e-21	SMART
GAF	254	441	3.21e-23	SMART
low complexity region	478	495	N/A	INTRINSIC
Blast:HDc	496	540	3e-11	BLAST
HDc	556	734	6.95e-8	SMART
Blast:HDc	759	786	1e-8	BLAST
low complexity region	817	837	N/A	INTRINSIC
low complexity region	839	853	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000076842

SMART Domains

Protein: ENSMUSP00000100598
Gene: ENSMUSG00000057244

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S5	29	95	3.9e-30	PFAM
Pfam:Ribosomal_S5_C	112	185	1.9e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170335

SMART Domains

Protein: ENSMUSP00000133092
Gene: ENSMUSG00000091957

Domain	Start	End	E-Value	Type
low complexity region	6	53	N/A	INTRINSIC
Pfam:Ribosomal_S5	102	166	5.7e-34	PFAM
Pfam:Ribosomal_S5_C	185	256	2.4e-30	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,682,989	G1037*	probably null	Het
Abca8a	A	G	11: 110,050,966	I1159T	probably benign	Het
Abcc1	T	C	16: 14,465,137	V1159A	possibly damaging	Het
Abcg5	A	G	17: 84,673,579	I194T	probably damaging	Het
Abtb2	A	G	2: 103,567,024	T100A	probably benign	Het
Adam4	C	T	12: 81,421,294	M184I	probably benign	Het
Afap1l2	T	C	19: 56,928,409	D155G	probably damaging	Het
Ahnak	T	C	19: 9,002,438	V362A	possibly damaging	Het
Ak7	C	T	12: 105,726,223	R179*	probably null	Het
Akap8	C	A	17: 32,315,477	G332C	probably damaging	Het
Akr1e1	T	A	13: 4,595,072	Q204L	probably damaging	Het
Ankrd12	T	C	17: 65,986,227	E737G	possibly damaging	Het
Atrn	A	G	2: 130,972,288	D718G	probably benign	Het
Bco2	A	G	9: 50,541,169	S200P	possibly damaging	Het
C030005K15Rik	A	T	10: 97,725,786	S28T	unknown	Het
Cdc14a	T	A	3: 116,298,473	Q356L	possibly damaging	Het
Cdk5rap3	A	G	11: 96,908,828	L387P	probably damaging	Het
Celsr1	A	T	15: 86,030,323	S1150T	probably damaging	Het
Cntfr	A	G	4: 41,670,841		probably null	Het
Cramp1l	T	C	17: 24,964,910	N1244D	probably damaging	Het
Csmd3	G	T	15: 47,857,920	D1542E	possibly damaging	Het
Cyp4f17	A	T	17: 32,517,969	I92F	probably benign	Het
Dhx30	A	T	9: 110,107,983		probably null	Het
Dlg1	T	A	16: 31,743,147	H120Q	probably benign	Het
Dmgdh	A	T	13: 93,706,699	M348L	probably benign	Het
Dnmt3b	G	A	2: 153,683,639	E741K	possibly damaging	Het
Dock3	T	G	9: 107,025,335	H292P	probably damaging	Het
Elmsan1	A	G	12: 84,158,974		probably null	Het
Ercc6	T	A	14: 32,517,028	N24K	probably benign	Het
Esco2	T	C	14: 65,827,277	Q338R	probably benign	Het
Etl4	T	C	2: 20,808,026		probably null	Het
Exoc7	A	T	11: 116,292,521	I498N	probably damaging	Het
Fap	G	A	2: 62,548,589	S123L	probably damaging	Het
Foxn1	T	C	11: 78,371,225	E106G	probably benign	Het
Fscb	T	A	12: 64,474,401	D97V	probably damaging	Het
Gabrg1	T	C	5: 70,782,253	T174A	possibly damaging	Het
Gan	C	T	8: 117,196,460	A461V	possibly damaging	Het
Gbp2	T	A	3: 142,630,523	D211E	possibly damaging	Het
Gm10271	A	T	10: 116,956,841	Y47N	unknown	Het
Gm17333	G	T	16: 77,852,823		noncoding transcript	Het
Gm1758	T	A	16: 14,502,278		noncoding transcript	Het
Golga3	A	G	5: 110,207,627	K989R	possibly damaging	Het
Gucy2g	C	A	19: 55,199,541	V1041F	probably damaging	Het
Guk1	A	T	11: 59,186,813	F25I	probably benign	Het
H2al1o	C	T	X: 9,572,090	E87K	possibly damaging	Het
Hemgn	C	A	4: 46,395,958	C426F	probably damaging	Het
Hps3	A	G	3: 20,012,695		probably null	Het
Il2rb	A	T	15: 78,483,987	D287E	probably damaging	Het
Ino80	A	T	2: 119,406,859	V1123D	probably damaging	Het
Kdm2b	A	G	5: 122,984,460		probably null	Het
Kif21a	A	T	15: 90,972,727		probably null	Het
Klhl33	A	T	14: 50,892,126	N347K	probably damaging	Het
Krt2	A	G	15: 101,816,426	F250L	possibly damaging	Het
Krt82	T	A	15: 101,543,384	N332I	possibly damaging	Het
Lgi1	A	G	19: 38,306,183	I444V	probably benign	Het
Lmod1	G	A	1: 135,325,124	V39M	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mex3d	T	C	10: 80,381,542	T149A	probably benign	Het
Mlxipl	A	C	5: 135,107,170	D83A	probably damaging	Het
Mroh8	T	A	2: 157,269,551	E161V	probably benign	Het
Mroh9	G	A	1: 163,056,778	T397I	probably damaging	Het
Mtss1	T	C	15: 59,058,400	D32G	possibly damaging	Het
Mus81	T	C	19: 5,483,476	D495G	probably benign	Het
Neurod1	A	C	2: 79,454,329	S237A	probably benign	Het
Npas1	G	A	7: 16,474,800	R51C	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
P2ry14	T	C	3: 59,115,853	N62S	probably damaging	Het
Pcdh15	A	G	10: 74,624,255	Y1308C	probably damaging	Het
Pcdhb14	A	T	18: 37,449,535	M565L	probably benign	Het
Pde8b	A	G	13: 95,042,019	V566A	probably benign	Het
Phf11b	G	T	14: 59,328,105	Q108K	probably benign	Het
Pikfyve	T	C	1: 65,252,557	Y1312H	probably damaging	Het
Plcb3	T	C	19: 6,956,013		probably benign	Het
Plxna2	G	A	1: 194,806,303	G1629D	probably damaging	Het
Plxnb1	T	C	9: 109,100,745	V223A	probably benign	Het
Prkca	A	T	11: 108,012,692	Y285N	possibly damaging	Het
Prl2a1	A	T	13: 27,808,571	N226I	probably damaging	Het
Pus7	A	C	5: 23,741,916	M636R	probably damaging	Het
Samd9l	G	A	6: 3,375,264	Q666*	probably null	Het
Sema3d	A	G	5: 12,584,887	D640G	probably benign	Het
Slc6a15	A	G	10: 103,400,260	I279V	probably benign	Het
Slk	T	C	19: 47,620,534	V642A	possibly damaging	Het
Spta1	T	A	1: 174,245,730	M2305K	probably damaging	Het
Srrt	T	C	5: 137,303,012		probably benign	Het
Stfa2l1	A	T	16: 36,156,858	I8L	probably benign	Het
Tap1	T	C	17: 34,194,925	L638P	probably benign	Het
Tbccd1	A	T	16: 22,822,245	L461M	probably benign	Het
Tecta	T	C	9: 42,378,049	T407A	probably benign	Het
Tmbim7	T	C	5: 3,657,493		probably null	Het
Tnrc18	C	A	5: 142,815,114	V30L	probably benign	Het
Tomm7	A	G	5: 23,844,027	F16S	probably damaging	Het
Ugt2a2	A	G	5: 87,474,456	S428P	probably benign	Het
Vmn1r189	T	C	13: 22,102,154	E171G	probably benign	Het
Vmn1r61	T	C	7: 5,611,325		probably benign	Het
Vmn2r120	A	T	17: 57,525,038	S250R	probably benign	Het
Vmn2r8	T	C	5: 108,803,106	R158G	probably benign	Het
Vmn2r98	A	T	17: 19,066,440	Y400F	probably damaging	Het
Vps13c	C	A	9: 67,893,985	Y582*	probably null	Het
Zfp518a	T	A	19: 40,915,556	F1310I	probably benign	Het
Zswim1	A	G	2: 164,825,400	I191V	probably benign	Het

Other mutations in Pde6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00583:Pde6a	APN	18	61257268	missense	probably damaging	1.00
IGL00896:Pde6a	APN	18	61220792	missense	possibly damaging	0.94
IGL01595:Pde6a	APN	18	61281528	missense	probably damaging	0.98
IGL02971:Pde6a	APN	18	61264255	missense	probably damaging	1.00
caffeinated	UTSW	18	61220606	start codon destroyed	probably null	0.95
R0219:Pde6a	UTSW	18	61285935	missense	possibly damaging	0.57
R0968:Pde6a	UTSW	18	61253738	missense	probably damaging	0.99
R1304:Pde6a	UTSW	18	61258293	missense	probably damaging	0.99
R1498:Pde6a	UTSW	18	61232860	missense	possibly damaging	0.73
R1542:Pde6a	UTSW	18	61257045	missense	possibly damaging	0.93
R1734:Pde6a	UTSW	18	61285965	missense	probably damaging	1.00
R2173:Pde6a	UTSW	18	61254382	missense	probably damaging	1.00
R2280:Pde6a	UTSW	18	61262434	missense	probably damaging	1.00
R2281:Pde6a	UTSW	18	61262434	missense	probably damaging	1.00
R3617:Pde6a	UTSW	18	61231503	splice site	probably benign
R4620:Pde6a	UTSW	18	61262492	missense	probably damaging	1.00
R4727:Pde6a	UTSW	18	61231489	missense	probably benign	0.02
R4863:Pde6a	UTSW	18	61245592	missense	probably damaging	1.00
R4904:Pde6a	UTSW	18	61265034	missense	probably benign	0.08
R4945:Pde6a	UTSW	18	61234718	missense	probably damaging	1.00
R4953:Pde6a	UTSW	18	61231362	nonsense	probably null
R5323:Pde6a	UTSW	18	61232911	missense	possibly damaging	0.81
R5496:Pde6a	UTSW	18	61253665	critical splice acceptor site	probably null
R5540:Pde6a	UTSW	18	61231366	missense	probably damaging	0.99
R6180:Pde6a	UTSW	18	61284092	splice site	probably null
R6366:Pde6a	UTSW	18	61265071	splice site	probably null
R6743:Pde6a	UTSW	18	61263986	missense	possibly damaging	0.48
R7161:Pde6a	UTSW	18	61281525	missense	probably benign	0.05
R7186:Pde6a	UTSW	18	61220606	start codon destroyed	probably null	0.95
R7197:Pde6a	UTSW	18	61258224	missense	probably damaging	0.96
R7296:Pde6a	UTSW	18	61258293	missense	probably damaging	0.99
R7487:Pde6a	UTSW	18	61249960	missense	probably damaging	1.00
R7734:Pde6a	UTSW	18	61232866	missense	probably benign	0.10
R7818:Pde6a	UTSW	18	61281509	splice site	probably null
R8104:Pde6a	UTSW	18	61231494	missense	probably damaging	0.99
R8135:Pde6a	UTSW	18	61285925	missense	probably damaging	0.98
R8213:Pde6a	UTSW	18	61220696	missense	possibly damaging	0.94
R8266:Pde6a	UTSW	18	61258213	missense	probably damaging	1.00
R8429:Pde6a	UTSW	18	61232844	missense	probably damaging	0.98
R8472:Pde6a	UTSW	18	61220946	missense	probably damaging	1.00
R8805:Pde6a	UTSW	18	61257033	missense	probably benign	0.13
R8882:Pde6a	UTSW	18	61245548	missense
R9002:Pde6a	UTSW	18	61285989	missense	probably damaging	1.00
R9015:Pde6a	UTSW	18	61263976	missense	probably damaging	0.99
R9338:Pde6a	UTSW	18	61221037	missense	probably damaging	1.00
R9353:Pde6a	UTSW	18	61257311	missense	probably damaging	1.00
R9446:Pde6a	UTSW	18	61285996	missense	probably benign	0.00
R9458:Pde6a	UTSW	18	61254406	missense	probably damaging	1.00
RF018:Pde6a	UTSW	18	61231403	missense	possibly damaging	0.84
X0064:Pde6a	UTSW	18	61264948	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTTTTGGGAACAGAAAACCAG -3'
(R):5'- CAAGTTCAAGACCAGGCTGC -3'

Sequencing Primer
(F):5'- CAAAGAGCCGTGGGAATGC -3'
(R):5'- ACCACATGCTGAGCTCTGAG -3'

Posted On

2014-06-23