Incidental Mutation 'R0091:Lrrfip2'
ID20220
Institutional Source Beutler Lab
Gene Symbol Lrrfip2
Ensembl Gene ENSMUSG00000032497
Gene Nameleucine rich repeat (in FLII) interacting protein 2
Synonyms
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location111117592-111225668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111214243 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 506 (V506I)
Ref Sequence ENSEMBL: ENSMUSP00000149845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035078] [ENSMUST00000098340] [ENSMUST00000196981] [ENSMUST00000197241] [ENSMUST00000197256] [ENSMUST00000198986] [ENSMUST00000216430] [ENSMUST00000217117] [ENSMUST00000217341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035078
AA Change: V251I

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035078
Gene: ENSMUSG00000032497
AA Change: V251I

DomainStartEndE-ValueType
Pfam:DUF2051 31 340 2.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098340
AA Change: V236I

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095944
Gene: ENSMUSG00000032497
AA Change: V236I

DomainStartEndE-ValueType
Pfam:DUF2051 31 326 2.7e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196906
Predicted Effect possibly damaging
Transcript: ENSMUST00000196981
AA Change: V260I

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142851
Gene: ENSMUSG00000032497
AA Change: V260I

DomainStartEndE-ValueType
Pfam:DUF2051 31 350 4.5e-113 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197241
AA Change: V251I

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142816
Gene: ENSMUSG00000032497
AA Change: V251I

DomainStartEndE-ValueType
Pfam:DUF2051 31 341 1.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197256
AA Change: V273I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143322
Gene: ENSMUSG00000032497
AA Change: V273I

DomainStartEndE-ValueType
Pfam:DUF2051 31 363 2.9e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197540
Predicted Effect probably benign
Transcript: ENSMUST00000198986
SMART Domains Protein: ENSMUSP00000143756
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 10 174 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199711
Predicted Effect possibly damaging
Transcript: ENSMUST00000216430
AA Change: V212I

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217117
AA Change: V209I

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000217341
AA Change: V506I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.2225 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Lrrfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Lrrfip2 APN 9 111219715 missense probably damaging 1.00
IGL01408:Lrrfip2 APN 9 111214216 missense probably benign 0.11
IGL01462:Lrrfip2 APN 9 111205849 critical splice donor site probably null
IGL01845:Lrrfip2 APN 9 111199660 splice site probably benign
IGL02218:Lrrfip2 APN 9 111219725 missense probably benign
IGL02986:Lrrfip2 APN 9 111161393 splice site probably null
R1101:Lrrfip2 UTSW 9 111190225 missense probably damaging 1.00
R1722:Lrrfip2 UTSW 9 111199761 missense probably damaging 1.00
R2334:Lrrfip2 UTSW 9 111219725 missense probably benign
R2336:Lrrfip2 UTSW 9 111222215 missense probably damaging 1.00
R3103:Lrrfip2 UTSW 9 111222210 missense probably damaging 1.00
R4357:Lrrfip2 UTSW 9 111199687 missense probably damaging 1.00
R5010:Lrrfip2 UTSW 9 111223972 missense possibly damaging 0.79
R5072:Lrrfip2 UTSW 9 111199804 missense probably damaging 1.00
R6026:Lrrfip2 UTSW 9 111214171 missense probably damaging 1.00
R6307:Lrrfip2 UTSW 9 111223953 missense probably damaging 1.00
R6870:Lrrfip2 UTSW 9 111216119 intron probably benign
R7099:Lrrfip2 UTSW 9 111173108 missense probably benign 0.04
R7312:Lrrfip2 UTSW 9 111177457 intron probably null
R7429:Lrrfip2 UTSW 9 111185126 intron probably null
R7866:Lrrfip2 UTSW 9 111193081 missense possibly damaging 0.95
R7912:Lrrfip2 UTSW 9 111205768 missense probably damaging 1.00
R7949:Lrrfip2 UTSW 9 111193081 missense possibly damaging 0.95
R7993:Lrrfip2 UTSW 9 111205768 missense probably damaging 1.00
Z1176:Lrrfip2 UTSW 9 111161340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGATTGAGCCGTTTCCTCCAC -3'
(R):5'- CCACTGCTGGTTTCCCAGAATCAAG -3'

Sequencing Primer
(F):5'- GCAAACATTGTTACAGAGATGCC -3'
(R):5'- CTGGTTTCCCAGAATCAAGAATGC -3'
Posted On2013-04-11