Mutagenetix > Incidental Mutations

Incidental Mutation 'R0091:Dcn'

20222

Institutional Source

Beutler Lab

Gene Symbol

Dcn

Ensembl Gene

ENSMUSG00000019929

Gene Name

decorin

Synonyms

DC, SLRR1B

MMRRC Submission

038378-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0091 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

97479609-97518143 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97506689 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 169 (N169S)

Ref Sequence

ENSEMBL: ENSMUSP00000131431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105287] [ENSMUST00000163448]

Predicted Effect

probably benign
Transcript: ENSMUST00000105287
AA Change: N169S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000100924
Gene: ENSMUSG00000019929
AA Change: N169S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
LRRNT	48	80	3.86e-11	SMART
LRR	79	98	2.54e1	SMART
LRR	99	122	1.14e0	SMART
LRR_TYP	123	146	2.91e-2	SMART
LRR	147	167	1.67e2	SMART
LRR	168	193	1.29e2	SMART
LRR	194	217	5.27e1	SMART
LRR	239	262	6.05e0	SMART
LRR	263	286	1.01e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163448
AA Change: N169S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131431
Gene: ENSMUSG00000019929
AA Change: N169S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
LRRNT	48	80	3.86e-11	SMART
LRR	79	98	2.54e1	SMART
LRR	99	122	1.14e0	SMART
LRR_TYP	123	146	2.91e-2	SMART
LRR	147	167	1.67e2	SMART
LRR	168	193	1.29e2	SMART
LRR	194	217	5.27e1	SMART
LRR	239	262	6.05e0	SMART
LRR	263	286	1.01e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219539

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 99.1%
3x: 97.9%
10x: 94.4%
20x: 84.5%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded preproprotein is proteolytically processed to generate a mature protein product, which is secreted into the extracellular space to regulate collagen fibril assembly. Homozygous knockout mice for this gene exhibit enhanced tumorigenesis in a liver cancer model, and defects in collagen fibrils, leading to weakened skin and tendons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant mice have fragile skin and exhibit abnormal collagen morphology in skin and tendons, supporting this gene's role in regulating collagen fiber formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,138,530	S278P	possibly damaging	Het
Adam11	A	G	11: 102,772,839	Y281C	probably damaging	Het
Adam6a	G	T	12: 113,544,229	R74L	possibly damaging	Het
Adcy5	T	C	16: 35,270,998		probably null	Het
Adrb2	A	G	18: 62,179,019	L245P	probably benign	Het
Aebp2	T	C	6: 140,644,074		probably null	Het
Arhgap23	A	G	11: 97,452,244	T240A	probably benign	Het
Atp10a	T	C	7: 58,774,046		probably benign	Het
Atp13a4	T	A	16: 29,455,395	Y416F	probably damaging	Het
Atp5g2	A	C	15: 102,663,057	L133R	probably damaging	Het
Bicral	A	T	17: 46,825,307	Y326N	probably damaging	Het
Chst4	T	C	8: 110,030,665	S189G	probably damaging	Het
Cnot1	A	T	8: 95,763,144	I477N	probably damaging	Het
Col7a1	G	T	9: 108,967,506		probably benign	Het
Dchs1	A	G	7: 105,766,094		probably benign	Het
Dnajc6	T	C	4: 101,616,777		probably benign	Het
Egln3	A	G	12: 54,181,646	F225L	probably benign	Het
Erap1	G	A	13: 74,668,052	R100Q	possibly damaging	Het
Erc2	A	T	14: 27,776,824		probably null	Het
Fto	G	A	8: 91,441,807		probably null	Het
Gdap1l1	C	T	2: 163,446,091	P80S	probably damaging	Het
Gm1123	T	C	9: 99,023,352	E35G	possibly damaging	Het
Hhipl1	A	G	12: 108,321,897		probably benign	Het
Ift80	A	T	3: 68,914,675	L679Q	probably damaging	Het
Il18	A	G	9: 50,576,713		probably benign	Het
Inhbb	T	C	1: 119,417,395	Y388C	probably damaging	Het
Kmt2d	G	T	15: 98,844,479		probably benign	Het
Krt20	A	G	11: 99,437,814	V95A	probably damaging	Het
Lck	A	T	4: 129,555,681	S274R	possibly damaging	Het
Lrp1	T	A	10: 127,540,979	N4243I	probably damaging	Het
Lrrfip2	G	A	9: 111,214,243	V506I	probably damaging	Het
Ltbp2	A	G	12: 84,793,733	C1000R	probably damaging	Het
Matn3	G	A	12: 8,952,105	D106N	probably damaging	Het
Micalcl	A	G	7: 112,381,296	E49G	probably benign	Het
Mmadhc	A	G	2: 50,292,857	S36P	probably damaging	Het
Morn1	T	C	4: 155,145,172	Y433H	probably damaging	Het
Mpo	A	G	11: 87,801,610	M525V	probably benign	Het
Myo5a	C	T	9: 75,161,492	R659C	probably damaging	Het
Obox6	T	C	7: 15,834,439	S171G	probably benign	Het
Olfr1280	T	A	2: 111,316,173	D231E	probably benign	Het
Olfr347	A	G	2: 36,734,905	N195D	probably damaging	Het
Olfr998	A	T	2: 85,591,352	N271Y	probably benign	Het
P2ry14	A	G	3: 59,115,893	Y49H	probably benign	Het
Papss2	C	T	19: 32,633,902	T17I	possibly damaging	Het
Pcid2	T	C	8: 13,085,392	T206A	probably benign	Het
Pex6	A	G	17: 46,711,918	E140G	probably damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prdx2	T	G	8: 84,971,701		probably benign	Het
Ptbp2	A	T	3: 119,720,661	L471Q	probably damaging	Het
Rbm33	T	A	5: 28,352,606	D232E	possibly damaging	Het
Rnf214	T	A	9: 45,898,493		probably null	Het
Rora	G	A	9: 69,374,048	R314H	probably damaging	Het
Rufy4	T	C	1: 74,128,936		probably benign	Het
Sag	T	C	1: 87,814,680	V58A	probably damaging	Het
Serpina3i	C	T	12: 104,265,164	T20M	probably damaging	Het
Slc4a5	A	G	6: 83,277,555	N578S	probably benign	Het
Soat2	A	G	15: 102,158,139	Y285C	probably damaging	Het
Syk	A	G	13: 52,640,733	Y478C	probably damaging	Het
Syne4	G	A	7: 30,318,919	G362E	probably damaging	Het
Tas2r126	A	T	6: 42,435,102	M190L	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttc19	A	G	11: 62,309,084	D218G	probably damaging	Het
Tut1	T	C	19: 8,965,436	V629A	probably damaging	Het
Txndc11	T	C	16: 11,088,104	N521D	probably benign	Het
Ushbp1	T	C	8: 71,388,970	E405G	possibly damaging	Het
Usp46	C	T	5: 74,003,257	R246Q	probably benign	Het
Utrn	T	C	10: 12,735,204	D469G	probably damaging	Het
Vmn2r104	T	A	17: 20,041,813	I352F	possibly damaging	Het
Wdr4	G	A	17: 31,496,916	T398I	probably benign	Het
Ythdc1	T	A	5: 86,820,701		probably benign	Het

Other mutations in Dcn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01519:Dcn	APN	10	97483523	missense	probably damaging	1.00
IGL01776:Dcn	APN	10	97495076	missense	possibly damaging	0.88
IGL02608:Dcn	APN	10	97483457	missense	probably damaging	0.99
IGL02990:Dcn	APN	10	97509973	missense	probably benign	0.00
IGL03181:Dcn	APN	10	97483452	missense	probably damaging	0.98
IGL03268:Dcn	APN	10	97483378	missense	probably benign
PIT4791001:Dcn	UTSW	10	97507742	missense	probably benign
R0267:Dcn	UTSW	10	97506483	splice site	probably benign
R1759:Dcn	UTSW	10	97513655	missense	probably benign	0.01
R1845:Dcn	UTSW	10	97506674	missense	probably benign	0.00
R5322:Dcn	UTSW	10	97517602	missense	probably benign	0.03
R6613:Dcn	UTSW	10	97495040	missense	probably benign	0.03
R6650:Dcn	UTSW	10	97507743	missense	probably benign	0.00
R7392:Dcn	UTSW	10	97509998	missense	probably damaging	0.98
R7596:Dcn	UTSW	10	97510009	missense	probably damaging	1.00
R7626:Dcn	UTSW	10	97483478	missense	possibly damaging	0.75
R7957:Dcn	UTSW	10	97510194	intron	probably null
R8049:Dcn	UTSW	10	97513617	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCAAAATCAGTCCAGAGGCATTC -3'
(R):5'- TCTTCCCTCCATGCTAGATCATCAAGG -3'

Sequencing Primer
(F):5'- CAAACCTCTCGTGAAGTTGG -3'
(R):5'- TCCATGCTAGATCATCAAGGTCAAAG -3'

Posted On

2013-04-11