Incidental Mutation 'R0091:Ttc19'
ID20224
Institutional Source Beutler Lab
Gene Symbol Ttc19
Ensembl Gene ENSMUSG00000042298
Gene Nametetratricopeptide repeat domain 19
Synonyms
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0091 (G1)
Quality Score163
Status Validated (trace)
Chromosome11
Chromosomal Location62281473-62328451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62309084 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 218 (D218G)
Ref Sequence ENSEMBL: ENSMUSP00000098636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050646] [ENSMUST00000101075]
Predicted Effect probably damaging
Transcript: ENSMUST00000050646
AA Change: D231G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054367
Gene: ENSMUSG00000042298
AA Change: D231G

DomainStartEndE-ValueType
low complexity region 3 29 N/A INTRINSIC
low complexity region 77 86 N/A INTRINSIC
Blast:TPR 87 120 9e-6 BLAST
Blast:TPR 128 160 1e-9 BLAST
Pfam:TPR_12 216 301 1.1e-14 PFAM
Pfam:TPR_10 226 267 2.4e-6 PFAM
Pfam:TPR_10 307 339 5.4e-6 PFAM
Pfam:TPR_2 308 339 8.2e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101075
AA Change: D218G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098636
Gene: ENSMUSG00000042298
AA Change: D218G

DomainStartEndE-ValueType
low complexity region 3 29 N/A INTRINSIC
low complexity region 77 86 N/A INTRINSIC
Blast:TPR 87 120 9e-6 BLAST
Pfam:TPR_12 210 288 1.8e-14 PFAM
Pfam:TPR_10 213 254 3.4e-6 PFAM
Pfam:TPR_10 255 293 2e-3 PFAM
Pfam:TPR_10 294 327 3.7e-5 PFAM
Pfam:TPR_2 295 326 8e-5 PFAM
Pfam:TPR_1 296 326 8.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154976
Predicted Effect unknown
Transcript: ENSMUST00000162385
AA Change: D110G
SMART Domains Protein: ENSMUSP00000125618
Gene: ENSMUSG00000042298
AA Change: D110G

DomainStartEndE-ValueType
Blast:TPR 8 40 4e-10 BLAST
Pfam:TPR_12 97 181 6.3e-15 PFAM
Pfam:TPR_10 106 147 2e-6 PFAM
Meta Mutation Damage Score 0.2669 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a tetratricopeptide repeat (TPR) domain containing several TPRs of about 34 aa each. These repeats are found in a variety of organisms including bacteria, fungi and plants, and are involved in a variety of functions including protein-protein interactions. This protein is embedded in the inner mitochondrial membrane and is involved in the formation of the mitochondrial respiratory chain III. It has also been suggested that this protein plays a role in cytokinesis. Mutations in this gene cause mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Ttc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Ttc19 APN 11 62313113 missense probably damaging 1.00
R1929:Ttc19 UTSW 11 62281824 missense probably benign 0.21
R2291:Ttc19 UTSW 11 62283693 missense probably damaging 1.00
R4290:Ttc19 UTSW 11 62285927 intron probably null
R4681:Ttc19 UTSW 11 62309091 nonsense probably null
R4824:Ttc19 UTSW 11 62309096 missense probably benign 0.32
R5411:Ttc19 UTSW 11 62284151 missense probably benign 0.06
R5790:Ttc19 UTSW 11 62281514 start codon destroyed probably null
R6984:Ttc19 UTSW 11 62314037 missense probably damaging 1.00
Z1176:Ttc19 UTSW 11 62314090 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCAGTGAAGCCTGGTAGCCACAAAG -3'
(R):5'- TGCCATGCAAGCTGAAATACGCCC -3'

Sequencing Primer
(F):5'- GATGAAGTACAGTGGCTTGC -3'
(R):5'- AGCACCCTTGAACCTGTG -3'
Posted On2013-04-11