Incidental Mutation 'R1796:Itpr2'
ID202255
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
MMRRC Submission 039826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1796 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146296673 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1533 (N1533S)
Ref Sequence ENSEMBL: ENSMUSP00000078526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]
Predicted Effect probably benign
Transcript: ENSMUST00000053273
AA Change: N1566S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: N1566S

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079573
AA Change: N1533S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: N1533S

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144557
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,372 P1808S probably damaging Het
Abcd4 G A 12: 84,615,382 S30F probably benign Het
Abtb1 T C 6: 88,836,619 D379G possibly damaging Het
Adgre1 A G 17: 57,441,350 I517V probably benign Het
AF366264 A T 8: 13,836,816 L425* probably null Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt4 G A 2: 151,938,989 V386M probably damaging Het
Asic1 A G 15: 99,696,654 H360R probably null Het
Asxl1 G A 2: 153,401,606 A1359T probably benign Het
Atp8a2 C T 14: 60,020,758 probably null Het
BC003331 T C 1: 150,375,554 N283S probably benign Het
C1qtnf2 T A 11: 43,491,287 F279I probably damaging Het
Car8 A T 4: 8,221,671 L100* probably null Het
Cd52 T C 4: 134,094,984 M1V probably null Het
Celf5 T C 10: 81,467,219 I163V possibly damaging Het
Cep250 A T 2: 155,992,187 T2010S possibly damaging Het
Cfap65 C T 1: 74,918,948 V934M probably damaging Het
Colec11 A T 12: 28,594,859 I212N probably damaging Het
Cpa3 C T 3: 20,223,227 probably null Het
Ctnnd1 G T 2: 84,615,209 H495N probably damaging Het
Cyb5a T C 18: 84,851,561 V28A probably benign Het
Ddo A T 10: 40,647,629 Q205L probably benign Het
Dnah1 T A 14: 31,261,093 N4195I probably benign Het
E2f1 A T 2: 154,560,929 V306E probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Eef1d A C 15: 75,901,175 F25C probably damaging Het
Ehd3 A T 17: 73,830,359 I508F probably damaging Het
Eml6 T A 11: 29,881,975 I232F probably benign Het
Enc1 T A 13: 97,246,483 D500E probably benign Het
Enc1 C A 13: 97,246,485 T501K possibly damaging Het
Fam126a T G 5: 23,986,151 T173P probably damaging Het
Fam83f C T 15: 80,690,082 R213W possibly damaging Het
Fbxo31 A T 8: 121,560,438 L158* probably null Het
Foxi3 C A 6: 70,960,810 T342N possibly damaging Het
Gm996 C T 2: 25,577,988 G637D probably damaging Het
Gpr179 T A 11: 97,336,556 D1591V possibly damaging Het
Gpsm2 A G 3: 108,701,850 V151A probably damaging Het
Grk2 T G 19: 4,287,940 I513L probably benign Het
H2-Ab1 A G 17: 34,267,372 E135G probably damaging Het
Herc1 A T 9: 66,388,856 K578* probably null Het
Kif3c A G 12: 3,367,299 N440S probably benign Het
Klhdc2 T C 12: 69,300,297 probably null Het
Kmo G T 1: 175,637,895 V72L probably benign Het
Krt71 A G 15: 101,742,880 I56T possibly damaging Het
Krt72 T C 15: 101,781,552 probably null Het
Krt78 T A 15: 101,950,865 Q299L probably damaging Het
Loxhd1 G A 18: 77,425,639 E1774K possibly damaging Het
Loxhd1 C T 18: 77,405,907 R1521C probably damaging Het
Ly6g6f T C 17: 35,083,502 S20G probably benign Het
Mecr T A 4: 131,865,071 M282K probably damaging Het
Mfsd14a G T 3: 116,634,947 A353D probably damaging Het
Mroh9 A T 1: 163,045,710 N564K probably damaging Het
Mrs2 T A 13: 24,997,128 T237S possibly damaging Het
Mycbpap A G 11: 94,507,551 L534S probably damaging Het
Myh1 T C 11: 67,224,357 I1906T probably benign Het
Myh4 T A 11: 67,260,324 V1935D probably benign Het
Myo18a T C 11: 77,829,344 I684T possibly damaging Het
Myo7b C T 18: 31,986,675 R788H possibly damaging Het
Nbea A T 3: 55,643,708 D2678E possibly damaging Het
Ndufs3 A C 2: 90,898,706 Y145* probably null Het
Nrros A G 16: 32,143,511 F563L probably damaging Het
Ntn4 T C 10: 93,745,771 V602A probably damaging Het
Obscn C A 11: 59,029,337 R6736L possibly damaging Het
Olfr159 T A 4: 43,770,495 D172V possibly damaging Het
Olfr26 T A 9: 38,855,524 V154D probably benign Het
Olfr698 T C 7: 106,752,549 I280V probably benign Het
Olfr837 C A 9: 19,137,917 T308K probably benign Het
Olfr969 C T 9: 39,796,005 P210L possibly damaging Het
Olfr972 A G 9: 39,873,971 E232G probably benign Het
Pik3cd A G 4: 149,654,119 F751L possibly damaging Het
Plekhh2 A G 17: 84,599,133 probably null Het
Postn A G 3: 54,373,756 H434R probably damaging Het
Prss39 A G 1: 34,500,033 D118G possibly damaging Het
Ralyl G T 3: 14,143,433 G211V possibly damaging Het
Rbak T A 5: 143,173,447 E617V probably damaging Het
Rbms3 A T 9: 116,719,333 W80R probably damaging Het
Retnlg A T 16: 48,874,247 Y86F probably benign Het
Rtel1 T A 2: 181,352,103 S643T probably benign Het
Serpina11 A T 12: 103,984,695 F256I probably damaging Het
Setd2 A T 9: 110,617,816 probably null Het
Setd2 A T 9: 110,550,345 Y1076F probably benign Het
Sgsm1 T C 5: 113,273,617 T248A possibly damaging Het
Slc6a21 T C 7: 45,280,755 Y193H probably damaging Het
Slfn9 T C 11: 82,981,955 K652E probably benign Het
Stt3b A T 9: 115,248,607 Y692* probably null Het
Sval3 A G 6: 41,968,162 Q8R probably benign Het
Synm T A 7: 67,734,000 I1305F possibly damaging Het
Tdrd1 T C 19: 56,837,783 F169L probably damaging Het
Tecta T A 9: 42,384,197 D334V probably damaging Het
Tle2 G A 10: 81,589,497 probably null Het
Tmem243 A G 5: 9,116,489 I30V probably benign Het
Treml2 T C 17: 48,309,502 *330R probably null Het
Trpm6 A G 19: 18,827,567 D961G possibly damaging Het
Ubr4 T C 4: 139,428,596 V2244A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc79 G T 12: 103,142,746 V2148F probably damaging Het
Ush2a A C 1: 188,910,827 T4129P probably benign Het
Vgll2 G A 10: 52,025,228 V85I probably damaging Het
Vmn1r16 T C 6: 57,323,271 Y122C probably benign Het
Vmn1r22 A T 6: 57,900,149 I91N probably damaging Het
Vmn2r70 A T 7: 85,563,803 Y465* probably null Het
Wdr64 A T 1: 175,717,331 E110V probably damaging Het
Wfdc6a A T 2: 164,580,311 C123S probably damaging Het
Xrcc1 A G 7: 24,547,827 Y30C probably damaging Het
Zdhhc7 T C 8: 120,085,418 K155R probably benign Het
Zfp560 A G 9: 20,351,930 F50S possibly damaging Het
Zfp616 C T 11: 74,085,845 T980I probably damaging Het
Zfp808 C T 13: 62,171,856 P300S probably damaging Het
Zfp979 G A 4: 147,613,283 T323I probably damaging Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
dollar_short UTSW 6 146397019 nonsense probably null
enfermos UTSW 6 146234006 missense probably damaging 0.98
Hopla UTSW 6 146194598 missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146354720 missense probably benign
PIT4453001:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146229871 missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1827:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146227524 splice site probably null
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6561:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
R7103:Itpr2 UTSW 6 146325074 missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146325056 missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146357796 nonsense probably null
R7165:Itpr2 UTSW 6 146294091 missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146311087 missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146311052 missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146158949 missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146327187 missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146359340 missense possibly damaging 0.95
R7414:Itpr2 UTSW 6 146373208 missense probably benign 0.06
R7448:Itpr2 UTSW 6 146329508 missense probably damaging 1.00
R7492:Itpr2 UTSW 6 146390938 missense probably damaging 1.00
R7515:Itpr2 UTSW 6 146327110 missense probably damaging 1.00
R7529:Itpr2 UTSW 6 146194598 missense probably damaging 0.98
R7558:Itpr2 UTSW 6 146390865 missense probably damaging 1.00
R7650:Itpr2 UTSW 6 146233994 missense probably benign 0.36
R7678:Itpr2 UTSW 6 146187550 missense probably benign 0.00
R7790:Itpr2 UTSW 6 146224776 missense probably damaging 1.00
R7798:Itpr2 UTSW 6 146386015 missense probably benign 0.06
R7831:Itpr2 UTSW 6 146291584 missense probably benign 0.04
R8023:Itpr2 UTSW 6 146187490 missense probably damaging 0.97
R8046:Itpr2 UTSW 6 146426459 missense probably damaging 0.96
R8236:Itpr2 UTSW 6 146390783 critical splice donor site probably null
R8241:Itpr2 UTSW 6 146418515 missense possibly damaging 0.90
R8245:Itpr2 UTSW 6 146373106 missense probably damaging 0.98
R8324:Itpr2 UTSW 6 146328398 missense probably damaging 0.97
R8339:Itpr2 UTSW 6 146312898 missense probably benign 0.19
R8458:Itpr2 UTSW 6 146233966 missense possibly damaging 0.62
R8506:Itpr2 UTSW 6 146418416 critical splice donor site probably null
R8529:Itpr2 UTSW 6 146329553 missense probably damaging 1.00
R8672:Itpr2 UTSW 6 146374518 missense probably damaging 1.00
R8755:Itpr2 UTSW 6 146232428 missense probably benign
R8816:Itpr2 UTSW 6 146241212 missense probably damaging 0.98
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGCAGGATTTAGAAATTATTCACG -3'
(R):5'- GGCAAAGTTGGAAGACTTACTCC -3'

Sequencing Primer
(F):5'- AGAAATTATTCACGTCACTTCCCG -3'
(R):5'- GAAGACTTACTCCTTCCTTCCTTC -3'
Posted On2014-06-23