Incidental Mutation 'R0091:Arhgap23'
ID20226
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97452244 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000103227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect probably benign
Transcript: ENSMUST00000107601
AA Change: T240A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: T240A

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121799
AA Change: T451A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: T451A

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142465
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCAATCAGATACCCCGCAGAG -3'
(R):5'- TCACCAAATCCAAGGTTCATCTGCC -3'

Sequencing Primer
(F):5'- TTGGAGGATGTGACTACCCAC -3'
(R):5'- AAGGTTCATCTGCCTTGCTG -3'
Posted On2013-04-11