Incidental Mutation 'R0091:Adam11'
ID20228
Institutional Source Beutler Lab
Gene Symbol Adam11
Ensembl Gene ENSMUSG00000020926
Gene Namea disintegrin and metallopeptidase domain 11
SynonymsMdc
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location102761439-102780262 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102772839 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 281 (Y281C)
Ref Sequence ENSEMBL: ENSMUSP00000099370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068150] [ENSMUST00000103081]
Predicted Effect probably damaging
Transcript: ENSMUST00000068150
AA Change: Y281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069466
Gene: ENSMUSG00000020926
AA Change: Y281C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 50 193 5.7e-29 PFAM
Pfam:Reprolysin_5 241 390 2.1e-9 PFAM
Pfam:Reprolysin 243 442 1.1e-68 PFAM
Pfam:Reprolysin_3 267 378 1.3e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103081
AA Change: Y281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099370
Gene: ENSMUSG00000020926
AA Change: Y281C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 193 1.1e-28 PFAM
Pfam:Reprolysin_5 241 390 2.3e-9 PFAM
Pfam:Reprolysin 243 442 5.3e-62 PFAM
Pfam:Reprolysin_3 267 385 4.5e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143269
Meta Mutation Damage Score 0.7764 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit defects in spatial learning, motor coordination and altered perception of pain. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and overtly normal but show impaired hippocampus-dependent spatial learning and cerebellum-dependent motor coordination when tested using water maze and rotating rod tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Adam11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adam11 APN 11 102776831 missense probably benign 0.40
IGL00497:Adam11 APN 11 102770147 missense probably damaging 1.00
IGL00570:Adam11 APN 11 102776350 missense possibly damaging 0.76
IGL01875:Adam11 APN 11 102772856 missense probably damaging 1.00
IGL01945:Adam11 APN 11 102772910 missense probably damaging 0.99
IGL02266:Adam11 APN 11 102772667 missense probably damaging 1.00
IGL02702:Adam11 APN 11 102777038 missense probably benign 0.26
IGL03395:Adam11 APN 11 102772920 missense probably damaging 1.00
G1citation:Adam11 UTSW 11 102776675 missense possibly damaging 0.68
R0135:Adam11 UTSW 11 102776573 missense probably damaging 1.00
R1068:Adam11 UTSW 11 102776378 missense probably damaging 1.00
R1529:Adam11 UTSW 11 102775113 critical splice donor site probably null
R2197:Adam11 UTSW 11 102769924 missense possibly damaging 0.94
R2357:Adam11 UTSW 11 102774508 missense probably benign
R3082:Adam11 UTSW 11 102770117 splice site probably benign
R3784:Adam11 UTSW 11 102774367 critical splice donor site probably null
R5254:Adam11 UTSW 11 102774272 nonsense probably null
R5367:Adam11 UTSW 11 102773653 missense probably benign 0.00
R5444:Adam11 UTSW 11 102772848 missense probably damaging 1.00
R5699:Adam11 UTSW 11 102773640 missense probably benign 0.00
R5881:Adam11 UTSW 11 102773810 missense probably benign 0.17
R6193:Adam11 UTSW 11 102771261 missense probably benign
R6422:Adam11 UTSW 11 102774283 missense possibly damaging 0.95
R6798:Adam11 UTSW 11 102777008 missense probably damaging 1.00
R6822:Adam11 UTSW 11 102776675 missense possibly damaging 0.68
R7173:Adam11 UTSW 11 102771931 missense possibly damaging 0.93
R7207:Adam11 UTSW 11 102772057 missense probably benign 0.03
R7719:Adam11 UTSW 11 102772477 missense probably benign 0.01
R8341:Adam11 UTSW 11 102776536 missense probably damaging 1.00
X0023:Adam11 UTSW 11 102774630 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTGGTAAGCACCGTCCCTACTC -3'
(R):5'- AGAAAGGCAAAGAGCACATTCCCTG -3'

Sequencing Primer
(F):5'- ACCGTCCCTACTCCCCTC -3'
(R):5'- AAGATCGCCTGGCACAG -3'
Posted On2013-04-11