Incidental Mutation 'R1796:Trpm6'
ID 202332
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 039826-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1796 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18804931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 961 (D961G)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect possibly damaging
Transcript: ENSMUST00000040489
AA Change: D961G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: D961G

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 G A 12: 84,662,156 (GRCm39) S30F probably benign Het
Abtb1 T C 6: 88,813,601 (GRCm39) D379G possibly damaging Het
Adgre1 A G 17: 57,748,350 (GRCm39) I517V probably benign Het
Ajm1 C T 2: 25,468,000 (GRCm39) G637D probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Angpt4 G A 2: 151,780,909 (GRCm39) V386M probably damaging Het
Asic1 A G 15: 99,594,535 (GRCm39) H360R probably null Het
Asxl1 G A 2: 153,243,526 (GRCm39) A1359T probably benign Het
Atp8a2 C T 14: 60,258,207 (GRCm39) probably null Het
Bltp3a T C 17: 28,109,045 (GRCm39) F1088S possibly damaging Het
C1qtnf2 T A 11: 43,382,114 (GRCm39) F279I probably damaging Het
Car8 A T 4: 8,221,671 (GRCm39) L100* probably null Het
Cd52 T C 4: 133,822,295 (GRCm39) M1V probably null Het
Celf5 T C 10: 81,303,053 (GRCm39) I163V possibly damaging Het
Cep250 A T 2: 155,834,107 (GRCm39) T2010S possibly damaging Het
Cfap65 C T 1: 74,958,107 (GRCm39) V934M probably damaging Het
Colec11 A T 12: 28,644,858 (GRCm39) I212N probably damaging Het
Cpa3 C T 3: 20,277,391 (GRCm39) probably null Het
Ctnnd1 G T 2: 84,445,553 (GRCm39) H495N probably damaging Het
Cyb5a T C 18: 84,869,686 (GRCm39) V28A probably benign Het
Ddo A T 10: 40,523,625 (GRCm39) Q205L probably benign Het
Dnah1 T A 14: 30,983,050 (GRCm39) N4195I probably benign Het
E2f1 A T 2: 154,402,849 (GRCm39) V306E probably benign Het
Ece1 C T 4: 137,685,312 (GRCm39) R601W probably damaging Het
Eef1d A C 15: 75,773,024 (GRCm39) F25C probably damaging Het
Ehd3 A T 17: 74,137,354 (GRCm39) I508F probably damaging Het
Eml6 T A 11: 29,831,975 (GRCm39) I232F probably benign Het
Enc1 T A 13: 97,382,991 (GRCm39) D500E probably benign Het
Enc1 C A 13: 97,382,993 (GRCm39) T501K possibly damaging Het
Fam83f C T 15: 80,574,283 (GRCm39) R213W possibly damaging Het
Fbxo31 A T 8: 122,287,177 (GRCm39) L158* probably null Het
Fcgbpl1 C T 7: 27,854,797 (GRCm39) P1808S probably damaging Het
Foxi3 C A 6: 70,937,794 (GRCm39) T342N possibly damaging Het
Gpr179 T A 11: 97,227,382 (GRCm39) D1591V possibly damaging Het
Gpsm2 A G 3: 108,609,166 (GRCm39) V151A probably damaging Het
Grk2 T G 19: 4,337,968 (GRCm39) I513L probably benign Het
H2-Ab1 A G 17: 34,486,346 (GRCm39) E135G probably damaging Het
Herc1 A T 9: 66,296,138 (GRCm39) K578* probably null Het
Hycc1 T G 5: 24,191,149 (GRCm39) T173P probably damaging Het
Itpr2 T C 6: 146,198,171 (GRCm39) N1533S probably benign Het
Kif3c A G 12: 3,417,299 (GRCm39) N440S probably benign Het
Klhdc2 T C 12: 69,347,071 (GRCm39) probably null Het
Kmo G T 1: 175,465,461 (GRCm39) V72L probably benign Het
Krt71 A G 15: 101,651,315 (GRCm39) I56T possibly damaging Het
Krt72 T C 15: 101,689,987 (GRCm39) probably null Het
Krt78 T A 15: 101,859,300 (GRCm39) Q299L probably damaging Het
Loxhd1 C T 18: 77,493,603 (GRCm39) R1521C probably damaging Het
Loxhd1 G A 18: 77,513,335 (GRCm39) E1774K possibly damaging Het
Ly6g6f T C 17: 35,302,478 (GRCm39) S20G probably benign Het
Mecr T A 4: 131,592,382 (GRCm39) M282K probably damaging Het
Mfsd14a G T 3: 116,428,596 (GRCm39) A353D probably damaging Het
Mroh9 A T 1: 162,873,279 (GRCm39) N564K probably damaging Het
Mrs2 T A 13: 25,181,111 (GRCm39) T237S possibly damaging Het
Mycbpap A G 11: 94,398,377 (GRCm39) L534S probably damaging Het
Myh1 T C 11: 67,115,183 (GRCm39) I1906T probably benign Het
Myh4 T A 11: 67,151,150 (GRCm39) V1935D probably benign Het
Myo18a T C 11: 77,720,170 (GRCm39) I684T possibly damaging Het
Myo7b C T 18: 32,119,728 (GRCm39) R788H possibly damaging Het
Nbea A T 3: 55,551,129 (GRCm39) D2678E possibly damaging Het
Ndufs3 A C 2: 90,729,050 (GRCm39) Y145* probably null Het
Nrros A G 16: 31,962,329 (GRCm39) F563L probably damaging Het
Ntn4 T C 10: 93,581,633 (GRCm39) V602A probably damaging Het
Obscn C A 11: 58,920,163 (GRCm39) R6736L possibly damaging Het
Odr4 T C 1: 150,251,305 (GRCm39) N283S probably benign Het
Or13c7d T A 4: 43,770,495 (GRCm39) D172V possibly damaging Het
Or2ag16 T C 7: 106,351,756 (GRCm39) I280V probably benign Het
Or7g22 C A 9: 19,049,213 (GRCm39) T308K probably benign Het
Or8d1 T A 9: 38,766,820 (GRCm39) V154D probably benign Het
Or8g54 C T 9: 39,707,301 (GRCm39) P210L possibly damaging Het
Or8g55 A G 9: 39,785,267 (GRCm39) E232G probably benign Het
Pik3cd A G 4: 149,738,576 (GRCm39) F751L possibly damaging Het
Plekhh2 A G 17: 84,906,561 (GRCm39) probably null Het
Postn A G 3: 54,281,177 (GRCm39) H434R probably damaging Het
Prss39 A G 1: 34,539,114 (GRCm39) D118G possibly damaging Het
Ralyl G T 3: 14,208,493 (GRCm39) G211V possibly damaging Het
Rbak T A 5: 143,159,202 (GRCm39) E617V probably damaging Het
Rbms3 A T 9: 116,548,401 (GRCm39) W80R probably damaging Het
Retnlg A T 16: 48,694,610 (GRCm39) Y86F probably benign Het
Rtel1 T A 2: 180,993,896 (GRCm39) S643T probably benign Het
Semp2l2a A T 8: 13,886,816 (GRCm39) L425* probably null Het
Serpina11 A T 12: 103,950,954 (GRCm39) F256I probably damaging Het
Setd2 A T 9: 110,379,413 (GRCm39) Y1076F probably benign Het
Setd2 A T 9: 110,446,884 (GRCm39) probably null Het
Sgsm1 T C 5: 113,421,483 (GRCm39) T248A possibly damaging Het
Slc6a21 T C 7: 44,930,179 (GRCm39) Y193H probably damaging Het
Slfn9 T C 11: 82,872,781 (GRCm39) K652E probably benign Het
Stt3b A T 9: 115,077,675 (GRCm39) Y692* probably null Het
Sval3 A G 6: 41,945,096 (GRCm39) Q8R probably benign Het
Synm T A 7: 67,383,748 (GRCm39) I1305F possibly damaging Het
Tdrd1 T C 19: 56,826,215 (GRCm39) F169L probably damaging Het
Tecta T A 9: 42,295,493 (GRCm39) D334V probably damaging Het
Tle2 G A 10: 81,425,331 (GRCm39) probably null Het
Tmem243 A G 5: 9,166,489 (GRCm39) I30V probably benign Het
Treml2 T C 17: 48,616,530 (GRCm39) *330R probably null Het
Ubr4 T C 4: 139,155,907 (GRCm39) V2244A probably benign Het
Unc79 G T 12: 103,109,005 (GRCm39) V2148F probably damaging Het
Ush2a A C 1: 188,643,024 (GRCm39) T4129P probably benign Het
Vgll2 G A 10: 51,901,324 (GRCm39) V85I probably damaging Het
Vmn1r16 T C 6: 57,300,256 (GRCm39) Y122C probably benign Het
Vmn1r22 A T 6: 57,877,134 (GRCm39) I91N probably damaging Het
Vmn2r70 A T 7: 85,213,011 (GRCm39) Y465* probably null Het
Wdr64 A T 1: 175,544,897 (GRCm39) E110V probably damaging Het
Wfdc6a A T 2: 164,422,231 (GRCm39) C123S probably damaging Het
Xrcc1 A G 7: 24,247,252 (GRCm39) Y30C probably damaging Het
Zdhhc7 T C 8: 120,812,157 (GRCm39) K155R probably benign Het
Zfp560 A G 9: 20,263,226 (GRCm39) F50S possibly damaging Het
Zfp616 C T 11: 73,976,671 (GRCm39) T980I probably damaging Het
Zfp808 C T 13: 62,319,670 (GRCm39) P300S probably damaging Het
Zfp979 G A 4: 147,697,740 (GRCm39) T323I probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGATTCTCAGATCGGCTTGG -3'
(R):5'- ACAAACATGTGCACACGTTC -3'

Sequencing Primer
(F):5'- GGCAAGTGCTCTGTAACATTACTGC -3'
(R):5'- GTGCACACGTTCATATATCACAAGAG -3'
Posted On 2014-06-23