Incidental Mutation 'R1797:Clca3a2'
ID 202351
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission 039827-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R1797 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144502320-144525255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144503398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 851 (Y851H)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably benign
Transcript: ENSMUST00000029929
AA Change: Y851H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: Y851H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197013
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,089,285 (GRCm39) K200E possibly damaging Het
Abcc2 A G 19: 43,803,225 (GRCm39) E687G possibly damaging Het
Abcc2 A T 19: 43,822,426 (GRCm39) Q1421H probably damaging Het
Abcg3 C T 5: 105,087,030 (GRCm39) S534N possibly damaging Het
Acp1 A G 12: 30,946,113 (GRCm39) probably null Het
Adam12 C A 7: 133,569,590 (GRCm39) R295L probably benign Het
Albfm1 A T 5: 90,727,460 (GRCm39) E359D probably damaging Het
Alg1 C A 16: 5,057,007 (GRCm39) H213Q probably benign Het
Ap4b1 T A 3: 103,726,149 (GRCm39) W410R possibly damaging Het
As3mt A G 19: 46,713,373 (GRCm39) T307A possibly damaging Het
Cdc14a T C 3: 116,115,843 (GRCm39) I289V probably damaging Het
Cdk17 A G 10: 93,044,114 (GRCm39) I18V possibly damaging Het
Cep131 C T 11: 119,964,562 (GRCm39) probably null Het
Cnih2 T C 19: 5,144,314 (GRCm39) K66E probably benign Het
Cpsf3 T A 12: 21,356,851 (GRCm39) N491K probably benign Het
Cux1 C T 5: 136,304,169 (GRCm39) E1253K probably benign Het
Dcc A C 18: 71,500,232 (GRCm39) L1005R probably damaging Het
Ddx19b A T 8: 111,739,439 (GRCm39) M200K probably damaging Het
Ech1 A G 7: 28,531,288 (GRCm39) Y292C probably damaging Het
Edc4 G T 8: 106,617,717 (GRCm39) A1121S probably benign Het
Eml6 T A 11: 29,832,041 (GRCm39) I210F probably benign Het
Fam135b T C 15: 71,324,290 (GRCm39) T1226A probably benign Het
Flg2 C T 3: 93,108,283 (GRCm39) R104C probably damaging Het
Frzb T C 2: 80,276,872 (GRCm39) I105V possibly damaging Het
Gli3 A G 13: 15,888,097 (GRCm39) D504G probably damaging Het
Gm42669 A T 5: 107,655,683 (GRCm39) K1161* probably null Het
Gm6665 T C 18: 31,953,186 (GRCm39) E63G possibly damaging Het
Gm9923 T C 10: 72,145,593 (GRCm39) V148A probably benign Het
Hoxc5 T C 15: 102,922,866 (GRCm39) I118T probably benign Het
Hsp90b1 A G 10: 86,537,609 (GRCm39) V232A possibly damaging Het
Impdh1 T A 6: 29,207,168 (GRCm39) I59F probably damaging Het
Iqch G A 9: 63,495,659 (GRCm39) P111S possibly damaging Het
Itih1 G T 14: 30,651,856 (GRCm39) Q829K probably damaging Het
Kcnh2 C T 5: 24,527,670 (GRCm39) R894H probably damaging Het
Kmt5b G T 19: 3,864,833 (GRCm39) E632D probably benign Het
L2hgdh C T 12: 69,746,340 (GRCm39) M373I probably benign Het
Map3k4 C T 17: 12,482,906 (GRCm39) E604K probably benign Het
Mok T A 12: 110,774,479 (GRCm39) Y420F probably benign Het
Nedd1 G A 10: 92,534,601 (GRCm39) T303I possibly damaging Het
Nipal4 T A 11: 46,042,160 (GRCm39) M174L probably benign Het
Or6c213 A C 10: 129,574,578 (GRCm39) I69M probably benign Het
Pag1 T A 3: 9,758,946 (GRCm39) T391S probably benign Het
Palm3 A G 8: 84,755,432 (GRCm39) R315G probably benign Het
Patj C T 4: 98,575,675 (GRCm39) R1177W probably damaging Het
Pbld2 G A 10: 62,910,903 (GRCm39) probably null Het
Phldb1 A T 9: 44,627,842 (GRCm39) M81K probably damaging Het
Pkn2 A G 3: 142,515,289 (GRCm39) F682L probably damaging Het
Plce1 T C 19: 38,747,392 (GRCm39) probably null Het
Plekha8 T A 6: 54,617,959 (GRCm39) V518E probably damaging Het
Ppp1r3a T A 6: 14,717,981 (GRCm39) M978L probably benign Het
Ppp4r4 T A 12: 103,564,410 (GRCm39) C592S possibly damaging Het
Prdx6b T A 2: 80,123,546 (GRCm39) D118E possibly damaging Het
Ptprg T C 14: 12,199,743 (GRCm38) V52A probably damaging Het
Rab27b A G 18: 70,122,617 (GRCm39) M114T probably damaging Het
Ralgps1 A G 2: 33,230,723 (GRCm39) probably null Het
Rasa3 G A 8: 13,632,372 (GRCm39) P506L probably benign Het
Rps6kb1 G A 11: 86,393,634 (GRCm39) R499* probably null Het
S1pr4 A G 10: 81,335,024 (GRCm39) M150T probably damaging Het
Scube2 T C 7: 109,430,882 (GRCm39) D439G probably damaging Het
Serpina1e T C 12: 103,917,150 (GRCm39) K173R probably benign Het
Serpina3m T A 12: 104,355,774 (GRCm39) I147N probably damaging Het
Sh3rf3 G T 10: 58,922,489 (GRCm39) G522* probably null Het
Smad1 A T 8: 80,070,473 (GRCm39) V355E probably damaging Het
Srsf11 A G 3: 157,725,065 (GRCm39) V211A possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stt3a C T 9: 36,654,711 (GRCm39) probably null Het
Syne2 T C 12: 76,010,557 (GRCm39) V2488A probably benign Het
Tbc1d23 T C 16: 56,993,463 (GRCm39) T568A possibly damaging Het
Tnn A C 1: 159,968,258 (GRCm39) V378G probably damaging Het
Trim50 T C 5: 135,382,355 (GRCm39) V69A possibly damaging Het
Ttll10 A T 4: 156,132,024 (GRCm39) D19E probably damaging Het
Ushbp1 G A 8: 71,841,567 (GRCm39) R421C probably damaging Het
Vmn2r2 T C 3: 64,042,128 (GRCm39) T196A probably benign Het
Wdr64 G A 1: 175,639,585 (GRCm39) S1028N probably damaging Het
Wwtr1 T C 3: 57,369,996 (GRCm39) Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 (GRCm39) K216* probably null Het
Zfp39 T C 11: 58,791,486 (GRCm39) D67G probably damaging Het
Zfp40 A G 17: 23,394,514 (GRCm39) I691T possibly damaging Het
Zfp532 T C 18: 65,758,215 (GRCm39) V716A probably benign Het
Zfp616 T A 11: 73,976,105 (GRCm39) C791* probably null Het
Zfp932 G A 5: 110,144,489 (GRCm39) probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca3a2 APN 3 144,804,574 (GRCm39) missense probably damaging 1.00
IGL01019:Clca3a2 APN 3 144,519,388 (GRCm39) nonsense probably null
IGL01337:Clca3a2 APN 3 144,800,939 (GRCm39) missense probably damaging 1.00
IGL01389:Clca3a2 APN 3 144,783,629 (GRCm39) critical splice donor site probably null
IGL01595:Clca3a2 APN 3 144,793,768 (GRCm39) missense probably damaging 1.00
IGL01663:Clca3a2 APN 3 144,522,916 (GRCm39) missense probably damaging 0.97
IGL01704:Clca3a2 APN 3 144,800,979 (GRCm39) missense probably benign 0.04
IGL01779:Clca3a2 APN 3 144,525,139 (GRCm39) missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144,519,216 (GRCm39) missense probably benign
IGL02301:Clca3a2 APN 3 144,512,133 (GRCm39) missense probably damaging 0.98
IGL02416:Clca3a2 APN 3 144,790,777 (GRCm39) missense probably benign 0.02
IGL02455:Clca3a2 APN 3 144,787,172 (GRCm39) missense probably benign 0.00
IGL02481:Clca3a2 APN 3 144,790,701 (GRCm39) missense possibly damaging 0.92
IGL02526:Clca3a2 APN 3 144,793,779 (GRCm39) missense probably benign 0.02
IGL02619:Clca3a2 APN 3 144,512,083 (GRCm39) missense probably damaging 1.00
IGL02797:Clca3a2 APN 3 144,787,024 (GRCm39) missense probably benign 0.02
IGL02852:Clca3a2 APN 3 144,512,104 (GRCm39) missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144,522,529 (GRCm39) missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144,512,177 (GRCm39) missense probably damaging 1.00
IGL03253:Clca3a2 APN 3 144,777,324 (GRCm39) missense probably benign 0.41
IGL03256:Clca3a2 APN 3 144,792,153 (GRCm39) missense possibly damaging 0.75
IGL03294:Clca3a2 APN 3 144,803,530 (GRCm39) missense probably damaging 1.00
3370:Clca3a2 UTSW 3 144,783,738 (GRCm39) missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144,522,494 (GRCm39) missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144,519,659 (GRCm39) missense possibly damaging 0.90
R0479:Clca3a2 UTSW 3 144,796,610 (GRCm39) missense probably damaging 1.00
R0542:Clca3a2 UTSW 3 144,781,571 (GRCm39) splice site probably benign
R0629:Clca3a2 UTSW 3 144,778,000 (GRCm39) missense probably benign
R1249:Clca3a2 UTSW 3 144,508,765 (GRCm39) missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144,519,624 (GRCm39) splice site probably benign
R1488:Clca3a2 UTSW 3 144,789,925 (GRCm39) missense possibly damaging 0.49
R1523:Clca3a2 UTSW 3 144,777,405 (GRCm39) nonsense probably null
R1568:Clca3a2 UTSW 3 144,781,410 (GRCm39) nonsense probably null
R1586:Clca3a2 UTSW 3 144,516,477 (GRCm39) missense possibly damaging 0.94
R1650:Clca3a2 UTSW 3 144,797,973 (GRCm39) missense probably damaging 1.00
R1771:Clca3a2 UTSW 3 144,787,171 (GRCm39) missense probably benign 0.12
R1776:Clca3a2 UTSW 3 144,519,681 (GRCm39) missense probably damaging 1.00
R1869:Clca3a2 UTSW 3 144,512,164 (GRCm39) missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144,516,457 (GRCm39) missense probably benign
R1923:Clca3a2 UTSW 3 144,511,491 (GRCm39) missense probably damaging 1.00
R2101:Clca3a2 UTSW 3 144,783,699 (GRCm39) missense probably damaging 0.99
R2200:Clca3a2 UTSW 3 144,519,685 (GRCm39) missense probably benign 0.10
R2242:Clca3a2 UTSW 3 144,796,551 (GRCm39) missense probably damaging 0.98
R2324:Clca3a2 UTSW 3 144,512,041 (GRCm39) critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144,519,679 (GRCm39) missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144,512,088 (GRCm39) missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144,514,522 (GRCm39) unclassified probably benign
R3551:Clca3a2 UTSW 3 144,508,842 (GRCm39) missense probably damaging 1.00
R3751:Clca3a2 UTSW 3 144,777,216 (GRCm39) missense probably benign 0.04
R3952:Clca3a2 UTSW 3 144,508,822 (GRCm39) missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144,512,081 (GRCm39) missense probably benign 0.02
R4496:Clca3a2 UTSW 3 144,797,926 (GRCm39) missense possibly damaging 0.94
R4518:Clca3a2 UTSW 3 144,514,466 (GRCm39) missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144,511,444 (GRCm39) missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144,523,692 (GRCm39) missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144,512,263 (GRCm39) missense probably damaging 1.00
R4962:Clca3a2 UTSW 3 144,783,640 (GRCm39) missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144,512,104 (GRCm39) missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144,511,599 (GRCm39) missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R5344:Clca3a2 UTSW 3 144,793,703 (GRCm39) missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144,503,286 (GRCm39) missense probably benign 0.00
R5424:Clca3a2 UTSW 3 144,789,942 (GRCm39) missense probably damaging 0.99
R5656:Clca3a2 UTSW 3 144,503,393 (GRCm39) missense probably benign 0.26
R5931:Clca3a2 UTSW 3 144,797,886 (GRCm39) missense possibly damaging 0.88
R6059:Clca3a2 UTSW 3 144,516,531 (GRCm39) missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144,525,118 (GRCm39) missense probably damaging 0.99
R6181:Clca3a2 UTSW 3 144,796,469 (GRCm39) nonsense probably null
R6254:Clca3a2 UTSW 3 144,507,895 (GRCm39) missense probably benign
R6336:Clca3a2 UTSW 3 144,512,239 (GRCm39) missense probably benign
R6470:Clca3a2 UTSW 3 144,510,024 (GRCm39) splice site probably null
R6593:Clca3a2 UTSW 3 144,514,338 (GRCm39) critical splice donor site probably null
R6598:Clca3a2 UTSW 3 144,792,246 (GRCm39) nonsense probably null
R6631:Clca3a2 UTSW 3 144,519,405 (GRCm39) missense probably benign
R6826:Clca3a2 UTSW 3 144,523,815 (GRCm39) missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144,512,144 (GRCm39) missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144,514,462 (GRCm39) missense probably damaging 1.00
R7167:Clca3a2 UTSW 3 144,803,545 (GRCm39) missense probably benign 0.40
R7211:Clca3a2 UTSW 3 144,519,775 (GRCm39) missense probably benign 0.00
R7229:Clca3a2 UTSW 3 144,789,869 (GRCm39) missense probably damaging 1.00
R7256:Clca3a2 UTSW 3 144,796,608 (GRCm39) missense probably damaging 0.99
R7324:Clca3a2 UTSW 3 144,514,372 (GRCm39) missense probably damaging 0.99
R7365:Clca3a2 UTSW 3 144,804,545 (GRCm39) missense probably damaging 1.00
R7411:Clca3a2 UTSW 3 144,507,860 (GRCm39) missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144,503,362 (GRCm39) missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144,507,674 (GRCm39) makesense probably null
R7813:Clca3a2 UTSW 3 144,790,726 (GRCm39) missense probably benign 0.26
R7889:Clca3a2 UTSW 3 144,516,574 (GRCm39) nonsense probably null
R7946:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144,519,756 (GRCm39) missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144,511,527 (GRCm39) missense probably damaging 1.00
R8077:Clca3a2 UTSW 3 144,777,288 (GRCm39) missense possibly damaging 0.56
R8169:Clca3a2 UTSW 3 144,783,653 (GRCm39) missense probably damaging 1.00
R8290:Clca3a2 UTSW 3 144,793,719 (GRCm39) missense possibly damaging 0.93
R8300:Clca3a2 UTSW 3 144,804,692 (GRCm39) missense probably benign 0.00
R8344:Clca3a2 UTSW 3 144,511,703 (GRCm39) critical splice acceptor site probably null
R8350:Clca3a2 UTSW 3 144,783,668 (GRCm39) missense probably benign 0.19
R8367:Clca3a2 UTSW 3 144,523,508 (GRCm39) splice site probably null
R8371:Clca3a2 UTSW 3 144,513,114 (GRCm39) nonsense probably null
R8814:Clca3a2 UTSW 3 144,503,525 (GRCm39) missense probably benign 0.18
R8854:Clca3a2 UTSW 3 144,783,852 (GRCm39) missense possibly damaging 0.94
R8876:Clca3a2 UTSW 3 144,777,360 (GRCm39) missense probably benign 0.00
R8887:Clca3a2 UTSW 3 144,790,810 (GRCm39) nonsense probably null
R9006:Clca3a2 UTSW 3 144,783,789 (GRCm39) missense probably damaging 0.99
R9031:Clca3a2 UTSW 3 144,511,475 (GRCm39) missense probably damaging 1.00
R9069:Clca3a2 UTSW 3 144,519,447 (GRCm39) splice site probably benign
R9093:Clca3a2 UTSW 3 144,781,481 (GRCm39) missense probably benign 0.20
R9190:Clca3a2 UTSW 3 144,796,599 (GRCm39) missense probably benign 0.00
R9201:Clca3a2 UTSW 3 144,519,684 (GRCm39) missense probably benign 0.00
R9209:Clca3a2 UTSW 3 144,778,005 (GRCm39) missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144,525,158 (GRCm39) missense probably benign
R9469:Clca3a2 UTSW 3 144,507,938 (GRCm39) missense probably damaging 1.00
R9501:Clca3a2 UTSW 3 144,777,322 (GRCm39) nonsense probably null
R9515:Clca3a2 UTSW 3 144,508,808 (GRCm39) nonsense probably null
R9569:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144,503,575 (GRCm39) missense probably damaging 1.00
X0025:Clca3a2 UTSW 3 144,792,265 (GRCm39) missense possibly damaging 0.87
Z1177:Clca3a2 UTSW 3 144,792,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATTCTAAAGCAACAGTCAGC -3'
(R):5'- ATACATCATCAGAGTGAGCCAGC -3'

Sequencing Primer
(F):5'- CAGTCAGCAAATATATACAGGGTTGC -3'
(R):5'- CATCCTCTGGGTCTCCAAGAAG -3'
Posted On 2014-06-23