Incidental Mutation 'R1797:Cux1'
ID202365
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
MMRRC Submission 039827-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R1797 (G1)
Quality Score94
Status Not validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136275315 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1253 (E1253K)
Ref Sequence ENSEMBL: ENSMUSP00000004097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect probably benign
Transcript: ENSMUST00000004097
AA Change: E1253K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: E1253K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163906
SMART Domains Protein: ENSMUSP00000131685
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
CUT 58 144 2.9e-42 SMART
HOX 184 246 3.3e-17 SMART
low complexity region 258 273 N/A INTRINSIC
low complexity region 351 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175975
AA Change: E1331K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: E1331K

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176172
AA Change: E1344K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: E1344K

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176486
AA Change: E1215K
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: E1215K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176778
AA Change: E1336K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: E1336K

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,198,459 K200E possibly damaging Het
5830473C10Rik A T 5: 90,579,601 E359D probably damaging Het
Abcc2 A G 19: 43,814,786 E687G possibly damaging Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Abcg3 C T 5: 104,939,164 S534N possibly damaging Het
Acp1 A G 12: 30,896,114 probably null Het
Adam12 C A 7: 133,967,861 R295L probably benign Het
Alg1 C A 16: 5,239,143 H213Q probably benign Het
Ap4b1 T A 3: 103,818,833 W410R possibly damaging Het
As3mt A G 19: 46,724,934 T307A possibly damaging Het
Cdc14a T C 3: 116,322,194 I289V probably damaging Het
Cdk17 A G 10: 93,208,252 I18V possibly damaging Het
Cep131 C T 11: 120,073,736 probably null Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Cnih2 T C 19: 5,094,286 K66E probably benign Het
Cpsf3 T A 12: 21,306,850 N491K probably benign Het
Dcc A C 18: 71,367,161 L1005R probably damaging Het
Ddx19b A T 8: 111,012,807 M200K probably damaging Het
Ech1 A G 7: 28,831,863 Y292C probably damaging Het
Edc4 G T 8: 105,891,085 A1121S probably benign Het
Eml6 T A 11: 29,882,041 I210F probably benign Het
Fam135b T C 15: 71,452,441 T1226A probably benign Het
Flg2 C T 3: 93,200,976 R104C probably damaging Het
Frzb T C 2: 80,446,528 I105V possibly damaging Het
Gli3 A G 13: 15,713,512 D504G probably damaging Het
Gm42669 A T 5: 107,507,817 K1161* probably null Het
Gm6665 T C 18: 31,820,133 E63G possibly damaging Het
Gm9923 T C 10: 72,309,763 V148A probably benign Het
Hoxc5 T C 15: 103,014,434 I118T probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Impdh1 T A 6: 29,207,169 I59F probably damaging Het
Iqch G A 9: 63,588,377 P111S possibly damaging Het
Itih1 G T 14: 30,929,899 Q829K probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kmt5b G T 19: 3,814,833 E632D probably benign Het
L2hgdh C T 12: 69,699,566 M373I probably benign Het
Map3k4 C T 17: 12,264,019 E604K probably benign Het
Mok T A 12: 110,808,045 Y420F probably benign Het
Nedd1 G A 10: 92,698,739 T303I possibly damaging Het
Nipal4 T A 11: 46,151,333 M174L probably benign Het
Olfr806 A C 10: 129,738,709 I69M probably benign Het
Pag1 T A 3: 9,693,886 T391S probably benign Het
Palm3 A G 8: 84,028,803 R315G probably benign Het
Patj C T 4: 98,687,438 R1177W probably damaging Het
Pbld2 G A 10: 63,075,124 probably null Het
Phldb1 A T 9: 44,716,545 M81K probably damaging Het
Pkn2 A G 3: 142,809,528 F682L probably damaging Het
Plce1 T C 19: 38,758,948 probably null Het
Plekha8 T A 6: 54,640,974 V518E probably damaging Het
Ppp1r3a T A 6: 14,717,982 M978L probably benign Het
Ppp4r4 T A 12: 103,598,151 C592S possibly damaging Het
Prdx6b T A 2: 80,293,202 D118E possibly damaging Het
Ptprg T C 14: 12,199,743 V52A probably damaging Het
Rab27b A G 18: 69,989,546 M114T probably damaging Het
Ralgps1 A G 2: 33,340,711 probably null Het
Rasa3 G A 8: 13,582,372 P506L probably benign Het
Rps6kb1 G A 11: 86,502,808 R499* probably null Het
S1pr4 A G 10: 81,499,190 M150T probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpina1e T C 12: 103,950,891 K173R probably benign Het
Serpina3m T A 12: 104,389,515 I147N probably damaging Het
Sh3rf3 G T 10: 59,086,667 G522* probably null Het
Smad1 A T 8: 79,343,844 V355E probably damaging Het
Srsf11 A G 3: 158,019,428 V211A possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stt3a C T 9: 36,743,415 probably null Het
Syne2 T C 12: 75,963,783 V2488A probably benign Het
Tbc1d23 T C 16: 57,173,100 T568A possibly damaging Het
Tnn A C 1: 160,140,688 V378G probably damaging Het
Trim50 T C 5: 135,353,501 V69A possibly damaging Het
Ttll10 A T 4: 156,047,567 D19E probably damaging Het
Ushbp1 G A 8: 71,388,923 R421C probably damaging Het
Vmn2r2 T C 3: 64,134,707 T196A probably benign Het
Wdr64 G A 1: 175,812,019 S1028N probably damaging Het
Wwtr1 T C 3: 57,462,575 Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 K216* probably null Het
Zfp39 T C 11: 58,900,660 D67G probably damaging Het
Zfp40 A G 17: 23,175,540 I691T possibly damaging Het
Zfp532 T C 18: 65,625,144 V716A probably benign Het
Zfp616 T A 11: 74,085,279 C791* probably null Het
Zfp932 G A 5: 109,996,623 probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 intron probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 intron probably null
Predicted Primers PCR Primer
(F):5'- TGCTTGGCAACGCAGAACTC -3'
(R):5'- CTCCACTTGTGTCTCACAGG -3'

Sequencing Primer
(F):5'- ACGCAGAACTCCTCTCGG -3'
(R):5'- GTGTCTCACAGGTCTCGGATC -3'
Posted On2014-06-23