Incidental Mutation 'R1797:Sh3rf3'
ID 202384
Institutional Source Beutler Lab
Gene Symbol Sh3rf3
Ensembl Gene ENSMUSG00000037990
Gene Name SH3 domain containing ring finger 3
Synonyms Sh3md4, 4831416G18Rik
MMRRC Submission 039827-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R1797 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 58649181-58974738 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 58922489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 522 (G522*)
Ref Sequence ENSEMBL: ENSMUSP00000120938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153031]
AlphaFold Q8C120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152924
Predicted Effect probably null
Transcript: ENSMUST00000153031
AA Change: G522*
SMART Domains Protein: ENSMUSP00000120938
Gene: ENSMUSG00000037990
AA Change: G522*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
SH3 461 518 1.43e-17 SMART
low complexity region 707 739 N/A INTRINSIC
SH3 822 878 5.19e-15 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,089,285 (GRCm39) K200E possibly damaging Het
Abcc2 A G 19: 43,803,225 (GRCm39) E687G possibly damaging Het
Abcc2 A T 19: 43,822,426 (GRCm39) Q1421H probably damaging Het
Abcg3 C T 5: 105,087,030 (GRCm39) S534N possibly damaging Het
Acp1 A G 12: 30,946,113 (GRCm39) probably null Het
Adam12 C A 7: 133,569,590 (GRCm39) R295L probably benign Het
Albfm1 A T 5: 90,727,460 (GRCm39) E359D probably damaging Het
Alg1 C A 16: 5,057,007 (GRCm39) H213Q probably benign Het
Ap4b1 T A 3: 103,726,149 (GRCm39) W410R possibly damaging Het
As3mt A G 19: 46,713,373 (GRCm39) T307A possibly damaging Het
Cdc14a T C 3: 116,115,843 (GRCm39) I289V probably damaging Het
Cdk17 A G 10: 93,044,114 (GRCm39) I18V possibly damaging Het
Cep131 C T 11: 119,964,562 (GRCm39) probably null Het
Clca3a2 A G 3: 144,503,398 (GRCm39) Y851H probably benign Het
Cnih2 T C 19: 5,144,314 (GRCm39) K66E probably benign Het
Cpsf3 T A 12: 21,356,851 (GRCm39) N491K probably benign Het
Cux1 C T 5: 136,304,169 (GRCm39) E1253K probably benign Het
Dcc A C 18: 71,500,232 (GRCm39) L1005R probably damaging Het
Ddx19b A T 8: 111,739,439 (GRCm39) M200K probably damaging Het
Ech1 A G 7: 28,531,288 (GRCm39) Y292C probably damaging Het
Edc4 G T 8: 106,617,717 (GRCm39) A1121S probably benign Het
Eml6 T A 11: 29,832,041 (GRCm39) I210F probably benign Het
Fam135b T C 15: 71,324,290 (GRCm39) T1226A probably benign Het
Flg2 C T 3: 93,108,283 (GRCm39) R104C probably damaging Het
Frzb T C 2: 80,276,872 (GRCm39) I105V possibly damaging Het
Gli3 A G 13: 15,888,097 (GRCm39) D504G probably damaging Het
Gm42669 A T 5: 107,655,683 (GRCm39) K1161* probably null Het
Gm6665 T C 18: 31,953,186 (GRCm39) E63G possibly damaging Het
Gm9923 T C 10: 72,145,593 (GRCm39) V148A probably benign Het
Hoxc5 T C 15: 102,922,866 (GRCm39) I118T probably benign Het
Hsp90b1 A G 10: 86,537,609 (GRCm39) V232A possibly damaging Het
Impdh1 T A 6: 29,207,168 (GRCm39) I59F probably damaging Het
Iqch G A 9: 63,495,659 (GRCm39) P111S possibly damaging Het
Itih1 G T 14: 30,651,856 (GRCm39) Q829K probably damaging Het
Kcnh2 C T 5: 24,527,670 (GRCm39) R894H probably damaging Het
Kmt5b G T 19: 3,864,833 (GRCm39) E632D probably benign Het
L2hgdh C T 12: 69,746,340 (GRCm39) M373I probably benign Het
Map3k4 C T 17: 12,482,906 (GRCm39) E604K probably benign Het
Mok T A 12: 110,774,479 (GRCm39) Y420F probably benign Het
Nedd1 G A 10: 92,534,601 (GRCm39) T303I possibly damaging Het
Nipal4 T A 11: 46,042,160 (GRCm39) M174L probably benign Het
Or6c213 A C 10: 129,574,578 (GRCm39) I69M probably benign Het
Pag1 T A 3: 9,758,946 (GRCm39) T391S probably benign Het
Palm3 A G 8: 84,755,432 (GRCm39) R315G probably benign Het
Patj C T 4: 98,575,675 (GRCm39) R1177W probably damaging Het
Pbld2 G A 10: 62,910,903 (GRCm39) probably null Het
Phldb1 A T 9: 44,627,842 (GRCm39) M81K probably damaging Het
Pkn2 A G 3: 142,515,289 (GRCm39) F682L probably damaging Het
Plce1 T C 19: 38,747,392 (GRCm39) probably null Het
Plekha8 T A 6: 54,617,959 (GRCm39) V518E probably damaging Het
Ppp1r3a T A 6: 14,717,981 (GRCm39) M978L probably benign Het
Ppp4r4 T A 12: 103,564,410 (GRCm39) C592S possibly damaging Het
Prdx6b T A 2: 80,123,546 (GRCm39) D118E possibly damaging Het
Ptprg T C 14: 12,199,743 (GRCm38) V52A probably damaging Het
Rab27b A G 18: 70,122,617 (GRCm39) M114T probably damaging Het
Ralgps1 A G 2: 33,230,723 (GRCm39) probably null Het
Rasa3 G A 8: 13,632,372 (GRCm39) P506L probably benign Het
Rps6kb1 G A 11: 86,393,634 (GRCm39) R499* probably null Het
S1pr4 A G 10: 81,335,024 (GRCm39) M150T probably damaging Het
Scube2 T C 7: 109,430,882 (GRCm39) D439G probably damaging Het
Serpina1e T C 12: 103,917,150 (GRCm39) K173R probably benign Het
Serpina3m T A 12: 104,355,774 (GRCm39) I147N probably damaging Het
Smad1 A T 8: 80,070,473 (GRCm39) V355E probably damaging Het
Srsf11 A G 3: 157,725,065 (GRCm39) V211A possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stt3a C T 9: 36,654,711 (GRCm39) probably null Het
Syne2 T C 12: 76,010,557 (GRCm39) V2488A probably benign Het
Tbc1d23 T C 16: 56,993,463 (GRCm39) T568A possibly damaging Het
Tnn A C 1: 159,968,258 (GRCm39) V378G probably damaging Het
Trim50 T C 5: 135,382,355 (GRCm39) V69A possibly damaging Het
Ttll10 A T 4: 156,132,024 (GRCm39) D19E probably damaging Het
Ushbp1 G A 8: 71,841,567 (GRCm39) R421C probably damaging Het
Vmn2r2 T C 3: 64,042,128 (GRCm39) T196A probably benign Het
Wdr64 G A 1: 175,639,585 (GRCm39) S1028N probably damaging Het
Wwtr1 T C 3: 57,369,996 (GRCm39) Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 (GRCm39) K216* probably null Het
Zfp39 T C 11: 58,791,486 (GRCm39) D67G probably damaging Het
Zfp40 A G 17: 23,394,514 (GRCm39) I691T possibly damaging Het
Zfp532 T C 18: 65,758,215 (GRCm39) V716A probably benign Het
Zfp616 T A 11: 73,976,105 (GRCm39) C791* probably null Het
Zfp932 G A 5: 110,144,489 (GRCm39) probably benign Het
Other mutations in Sh3rf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Sh3rf3 APN 10 58,885,178 (GRCm39) missense probably benign 0.06
IGL01898:Sh3rf3 APN 10 58,885,352 (GRCm39) missense probably damaging 0.99
IGL02108:Sh3rf3 APN 10 58,971,650 (GRCm39) missense probably damaging 1.00
IGL02148:Sh3rf3 APN 10 58,922,562 (GRCm39) missense probably benign 0.02
exasperated UTSW 10 58,922,646 (GRCm39) missense probably benign 0.06
strained UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R0421:Sh3rf3 UTSW 10 58,819,897 (GRCm39) missense probably damaging 1.00
R1056:Sh3rf3 UTSW 10 58,842,904 (GRCm39) missense probably damaging 1.00
R1313:Sh3rf3 UTSW 10 58,907,821 (GRCm39) missense possibly damaging 0.92
R1313:Sh3rf3 UTSW 10 58,907,821 (GRCm39) missense possibly damaging 0.92
R1615:Sh3rf3 UTSW 10 58,966,899 (GRCm39) missense probably benign 0.02
R1869:Sh3rf3 UTSW 10 58,919,335 (GRCm39) missense probably damaging 1.00
R1924:Sh3rf3 UTSW 10 58,939,989 (GRCm39) splice site probably benign
R1968:Sh3rf3 UTSW 10 58,649,809 (GRCm39) missense probably benign 0.32
R2353:Sh3rf3 UTSW 10 58,842,895 (GRCm39) missense probably damaging 1.00
R3617:Sh3rf3 UTSW 10 58,922,685 (GRCm39) missense possibly damaging 0.83
R3769:Sh3rf3 UTSW 10 58,820,013 (GRCm39) missense probably benign 0.07
R4059:Sh3rf3 UTSW 10 58,919,355 (GRCm39) missense probably damaging 1.00
R4425:Sh3rf3 UTSW 10 58,919,398 (GRCm39) missense probably benign 0.00
R4690:Sh3rf3 UTSW 10 58,649,526 (GRCm39) missense possibly damaging 0.93
R4832:Sh3rf3 UTSW 10 58,649,905 (GRCm39) missense probably benign 0.19
R4853:Sh3rf3 UTSW 10 58,919,341 (GRCm39) missense probably damaging 1.00
R4854:Sh3rf3 UTSW 10 58,649,545 (GRCm39) missense possibly damaging 0.93
R4917:Sh3rf3 UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R4918:Sh3rf3 UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R4995:Sh3rf3 UTSW 10 58,922,646 (GRCm39) missense probably benign 0.06
R5125:Sh3rf3 UTSW 10 58,967,012 (GRCm39) missense probably benign 0.14
R5640:Sh3rf3 UTSW 10 58,649,769 (GRCm39) missense probably benign
R5716:Sh3rf3 UTSW 10 58,967,105 (GRCm39) missense probably benign 0.03
R5756:Sh3rf3 UTSW 10 58,940,204 (GRCm39) missense probably damaging 0.98
R5848:Sh3rf3 UTSW 10 58,819,975 (GRCm39) missense possibly damaging 0.54
R5908:Sh3rf3 UTSW 10 58,885,270 (GRCm39) missense probably benign 0.32
R5930:Sh3rf3 UTSW 10 58,966,808 (GRCm39) missense probably damaging 1.00
R6036:Sh3rf3 UTSW 10 58,649,806 (GRCm39) missense probably benign 0.19
R6036:Sh3rf3 UTSW 10 58,649,806 (GRCm39) missense probably benign 0.19
R6392:Sh3rf3 UTSW 10 58,842,898 (GRCm39) missense probably damaging 0.97
R6450:Sh3rf3 UTSW 10 58,819,966 (GRCm39) missense probably damaging 1.00
R6470:Sh3rf3 UTSW 10 58,819,791 (GRCm39) missense probably damaging 1.00
R6639:Sh3rf3 UTSW 10 58,919,289 (GRCm39) missense probably damaging 1.00
R6685:Sh3rf3 UTSW 10 58,922,663 (GRCm39) missense possibly damaging 0.95
R7292:Sh3rf3 UTSW 10 58,907,795 (GRCm39) missense probably damaging 1.00
R7789:Sh3rf3 UTSW 10 58,922,637 (GRCm39) missense probably benign 0.01
R7941:Sh3rf3 UTSW 10 58,842,883 (GRCm39) missense probably damaging 0.99
R7959:Sh3rf3 UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R8140:Sh3rf3 UTSW 10 58,885,177 (GRCm39) missense possibly damaging 0.88
R8142:Sh3rf3 UTSW 10 58,885,205 (GRCm39) nonsense probably null
R8241:Sh3rf3 UTSW 10 58,940,242 (GRCm39) missense probably benign 0.11
R8406:Sh3rf3 UTSW 10 58,919,407 (GRCm39) missense probably damaging 1.00
R8725:Sh3rf3 UTSW 10 58,939,992 (GRCm39) critical splice acceptor site probably null
R8727:Sh3rf3 UTSW 10 58,939,992 (GRCm39) critical splice acceptor site probably null
R9341:Sh3rf3 UTSW 10 58,966,802 (GRCm39) missense probably damaging 0.99
R9343:Sh3rf3 UTSW 10 58,966,802 (GRCm39) missense probably damaging 0.99
RF020:Sh3rf3 UTSW 10 58,649,590 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACTGGGATTTCAAGCCTGTG -3'
(R):5'- CTGGGAGTTTTGTGTCCATACC -3'

Sequencing Primer
(F):5'- GATTTCAAGCCTGTGCGCAAC -3'
(R):5'- ATGGTGGTATCCCCGGC -3'
Posted On 2014-06-23