Incidental Mutation 'R0091:Soat2'
ID20239
Institutional Source Beutler Lab
Gene Symbol Soat2
Ensembl Gene ENSMUSG00000023045
Gene Namesterol O-acyltransferase 2
SynonymsACAT2, D15Wsu97e
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location102150526-102163469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102158139 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 285 (Y285C)
Ref Sequence ENSEMBL: ENSMUSP00000023806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023806]
Predicted Effect probably damaging
Transcript: ENSMUST00000023806
AA Change: Y285C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023806
Gene: ENSMUSG00000023045
AA Change: Y285C

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
Pfam:MBOAT 147 497 3.3e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160465
AA Change: Y255C
SMART Domains Protein: ENSMUSP00000124628
Gene: ENSMUSG00000023045
AA Change: Y255C

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Meta Mutation Damage Score 0.9328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene is a member of a small family of acyl coenzyme A:cholesterol acyltransferases. The gene encodes a membrane-bound enzyme localized in the endoplasmic reticulum that produces intracellular cholesterol esters from long-chain fatty acyl CoA and cholesterol. The cholesterol esters are then stored as cytoplasmic lipid droplets inside the cell. The enzyme is implicated in cholesterol absorption in the intestine and in the assembly and secretion of apolipoprotein B-containing lipoproteins such as very low density lipoprotein (VLDL). Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit elevated serum triglyceride levels and are resistant to fatty liver, hyperlipidemia, and gallstone development when fed a high fat, high cholesterol diet. When fed a Western diet homozygous mutant animals exhibit elevated HDL levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Soat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Soat2 APN 15 102162115 missense probably damaging 0.96
IGL03093:Soat2 APN 15 102157643 missense probably damaging 1.00
R0391:Soat2 UTSW 15 102158753 missense possibly damaging 0.92
R0396:Soat2 UTSW 15 102150707 unclassified probably benign
R1078:Soat2 UTSW 15 102153138 splice site probably null
R3421:Soat2 UTSW 15 102156809 splice site probably benign
R3422:Soat2 UTSW 15 102156809 splice site probably benign
R3754:Soat2 UTSW 15 102157078 missense probably damaging 1.00
R4062:Soat2 UTSW 15 102161091 missense possibly damaging 0.85
R4623:Soat2 UTSW 15 102157709 intron probably benign
R5004:Soat2 UTSW 15 102161111 missense probably damaging 1.00
R5808:Soat2 UTSW 15 102154025 splice site probably null
R6481:Soat2 UTSW 15 102162055 missense probably damaging 1.00
R6595:Soat2 UTSW 15 102160593 missense probably damaging 0.98
R6876:Soat2 UTSW 15 102160614 missense probably damaging 1.00
R7345:Soat2 UTSW 15 102162578 missense probably benign 0.13
R7429:Soat2 UTSW 15 102154300 missense probably damaging 1.00
R7572:Soat2 UTSW 15 102154021 critical splice donor site probably null
R7653:Soat2 UTSW 15 102162578 missense probably damaging 1.00
R7867:Soat2 UTSW 15 102151163 critical splice donor site probably null
R7910:Soat2 UTSW 15 102160671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACATGAGCATTCTCAGGCCCAC -3'
(R):5'- TCATGGCAATGTCCAGGGCAAAG -3'

Sequencing Primer
(F):5'- TTCTGAGAGAACCACGGTTAC -3'
(R):5'- GGAAGGCGCAGACTGTTTC -3'
Posted On2013-04-11