Incidental Mutation 'R1797:4933427D14Rik'
ID202395
Institutional Source Beutler Lab
Gene Symbol 4933427D14Rik
Ensembl Gene ENSMUSG00000020807
Gene NameRIKEN cDNA 4933427D14 gene
Synonyms
MMRRC Submission 039827-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1797 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72153929-72207459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72198459 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 200 (K200E)
Ref Sequence ENSEMBL: ENSMUSP00000122273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108505] [ENSMUST00000108506] [ENSMUST00000131546] [ENSMUST00000142530]
Predicted Effect probably benign
Transcript: ENSMUST00000108505
AA Change: K200E

PolyPhen 2 Score 0.404 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104145
Gene: ENSMUSG00000020807
AA Change: K200E

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108506
AA Change: K200E

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104146
Gene: ENSMUSG00000020807
AA Change: K200E

DomainStartEndE-ValueType
Pfam:DUF4673 1 954 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131546
AA Change: K200E

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122273
Gene: ENSMUSG00000020807
AA Change: K200E

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
coiled coil region 625 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142530
AA Change: K200E

PolyPhen 2 Score 0.404 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115276
Gene: ENSMUSG00000020807
AA Change: K200E

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154093
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,579,601 E359D probably damaging Het
Abcc2 A G 19: 43,814,786 E687G possibly damaging Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Abcg3 C T 5: 104,939,164 S534N possibly damaging Het
Acp1 A G 12: 30,896,114 probably null Het
Adam12 C A 7: 133,967,861 R295L probably benign Het
Alg1 C A 16: 5,239,143 H213Q probably benign Het
Ap4b1 T A 3: 103,818,833 W410R possibly damaging Het
As3mt A G 19: 46,724,934 T307A possibly damaging Het
Cdc14a T C 3: 116,322,194 I289V probably damaging Het
Cdk17 A G 10: 93,208,252 I18V possibly damaging Het
Cep131 C T 11: 120,073,736 probably null Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Cnih2 T C 19: 5,094,286 K66E probably benign Het
Cpsf3 T A 12: 21,306,850 N491K probably benign Het
Cux1 C T 5: 136,275,315 E1253K probably benign Het
Dcc A C 18: 71,367,161 L1005R probably damaging Het
Ddx19b A T 8: 111,012,807 M200K probably damaging Het
Ech1 A G 7: 28,831,863 Y292C probably damaging Het
Edc4 G T 8: 105,891,085 A1121S probably benign Het
Eml6 T A 11: 29,882,041 I210F probably benign Het
Fam135b T C 15: 71,452,441 T1226A probably benign Het
Flg2 C T 3: 93,200,976 R104C probably damaging Het
Frzb T C 2: 80,446,528 I105V possibly damaging Het
Gli3 A G 13: 15,713,512 D504G probably damaging Het
Gm42669 A T 5: 107,507,817 K1161* probably null Het
Gm6665 T C 18: 31,820,133 E63G possibly damaging Het
Gm9923 T C 10: 72,309,763 V148A probably benign Het
Hoxc5 T C 15: 103,014,434 I118T probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Impdh1 T A 6: 29,207,169 I59F probably damaging Het
Iqch G A 9: 63,588,377 P111S possibly damaging Het
Itih1 G T 14: 30,929,899 Q829K probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kmt5b G T 19: 3,814,833 E632D probably benign Het
L2hgdh C T 12: 69,699,566 M373I probably benign Het
Map3k4 C T 17: 12,264,019 E604K probably benign Het
Mok T A 12: 110,808,045 Y420F probably benign Het
Nedd1 G A 10: 92,698,739 T303I possibly damaging Het
Nipal4 T A 11: 46,151,333 M174L probably benign Het
Olfr806 A C 10: 129,738,709 I69M probably benign Het
Pag1 T A 3: 9,693,886 T391S probably benign Het
Palm3 A G 8: 84,028,803 R315G probably benign Het
Patj C T 4: 98,687,438 R1177W probably damaging Het
Pbld2 G A 10: 63,075,124 probably null Het
Phldb1 A T 9: 44,716,545 M81K probably damaging Het
Pkn2 A G 3: 142,809,528 F682L probably damaging Het
Plce1 T C 19: 38,758,948 probably null Het
Plekha8 T A 6: 54,640,974 V518E probably damaging Het
Ppp1r3a T A 6: 14,717,982 M978L probably benign Het
Ppp4r4 T A 12: 103,598,151 C592S possibly damaging Het
Prdx6b T A 2: 80,293,202 D118E possibly damaging Het
Ptprg T C 14: 12,199,743 V52A probably damaging Het
Rab27b A G 18: 69,989,546 M114T probably damaging Het
Ralgps1 A G 2: 33,340,711 probably null Het
Rasa3 G A 8: 13,582,372 P506L probably benign Het
Rps6kb1 G A 11: 86,502,808 R499* probably null Het
S1pr4 A G 10: 81,499,190 M150T probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpina1e T C 12: 103,950,891 K173R probably benign Het
Serpina3m T A 12: 104,389,515 I147N probably damaging Het
Sh3rf3 G T 10: 59,086,667 G522* probably null Het
Smad1 A T 8: 79,343,844 V355E probably damaging Het
Srsf11 A G 3: 158,019,428 V211A possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stt3a C T 9: 36,743,415 probably null Het
Syne2 T C 12: 75,963,783 V2488A probably benign Het
Tbc1d23 T C 16: 57,173,100 T568A possibly damaging Het
Tnn A C 1: 160,140,688 V378G probably damaging Het
Trim50 T C 5: 135,353,501 V69A possibly damaging Het
Ttll10 A T 4: 156,047,567 D19E probably damaging Het
Ushbp1 G A 8: 71,388,923 R421C probably damaging Het
Vmn2r2 T C 3: 64,134,707 T196A probably benign Het
Wdr64 G A 1: 175,812,019 S1028N probably damaging Het
Wwtr1 T C 3: 57,462,575 Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 K216* probably null Het
Zfp39 T C 11: 58,900,660 D67G probably damaging Het
Zfp40 A G 17: 23,175,540 I691T possibly damaging Het
Zfp532 T C 18: 65,625,144 V716A probably benign Het
Zfp616 T A 11: 74,085,279 C791* probably null Het
Zfp932 G A 5: 109,996,623 probably benign Het
Other mutations in 4933427D14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:4933427D14Rik APN 11 72178504 missense probably damaging 1.00
IGL01643:4933427D14Rik APN 11 72191588 missense probably damaging 1.00
IGL02004:4933427D14Rik APN 11 72191597 missense possibly damaging 0.62
IGL02308:4933427D14Rik APN 11 72202482 missense probably damaging 1.00
IGL02378:4933427D14Rik APN 11 72189598 missense probably benign 0.02
IGL02715:4933427D14Rik APN 11 72198888 missense probably damaging 1.00
IGL03330:4933427D14Rik APN 11 72159428 missense probably damaging 1.00
IGL03384:4933427D14Rik APN 11 72195847 missense possibly damaging 0.87
BB002:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
BB012:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
IGL03047:4933427D14Rik UTSW 11 72166726 missense possibly damaging 0.74
R0114:4933427D14Rik UTSW 11 72195799 missense probably damaging 1.00
R0526:4933427D14Rik UTSW 11 72169783 missense probably damaging 1.00
R0653:4933427D14Rik UTSW 11 72175545 nonsense probably null
R0669:4933427D14Rik UTSW 11 72198845 missense possibly damaging 0.73
R0729:4933427D14Rik UTSW 11 72159455 missense probably benign 0.07
R3973:4933427D14Rik UTSW 11 72198741 missense probably damaging 1.00
R4744:4933427D14Rik UTSW 11 72175539 missense probably damaging 0.98
R4897:4933427D14Rik UTSW 11 72191516 missense probably damaging 1.00
R5023:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5057:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5100:4933427D14Rik UTSW 11 72166651 missense probably damaging 1.00
R5497:4933427D14Rik UTSW 11 72165534 missense probably benign 0.22
R5556:4933427D14Rik UTSW 11 72175200 splice site probably null
R5631:4933427D14Rik UTSW 11 72176764 missense possibly damaging 0.71
R5683:4933427D14Rik UTSW 11 72202440 missense probably benign
R5742:4933427D14Rik UTSW 11 72165553 missense possibly damaging 0.63
R6247:4933427D14Rik UTSW 11 72158942 missense probably benign 0.02
R6267:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6296:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6860:4933427D14Rik UTSW 11 72189586 missense probably damaging 1.00
R7023:4933427D14Rik UTSW 11 72178403 critical splice donor site probably null
R7328:4933427D14Rik UTSW 11 72169780 critical splice donor site probably null
R7514:4933427D14Rik UTSW 11 72195802 missense probably damaging 1.00
R7544:4933427D14Rik UTSW 11 72198939 missense probably damaging 1.00
R7925:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
R8204:4933427D14Rik UTSW 11 72166780 missense probably benign 0.01
R8280:4933427D14Rik UTSW 11 72195841 missense possibly damaging 0.70
R8316:4933427D14Rik UTSW 11 72168786 missense possibly damaging 0.70
R8366:4933427D14Rik UTSW 11 72176695 nonsense probably null
R8384:4933427D14Rik UTSW 11 72166765 missense probably benign 0.08
R8722:4933427D14Rik UTSW 11 72189596 missense probably benign 0.00
X0063:4933427D14Rik UTSW 11 72176769 missense probably benign
X0065:4933427D14Rik UTSW 11 72189575 missense possibly damaging 0.65
Z1176:4933427D14Rik UTSW 11 72159000 missense probably benign 0.12
Z1186:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1186:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1186:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195710 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1187:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1187:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1188:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1188:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1189:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1189:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1190:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1190:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1191:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1191:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1192:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1192:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAACTAGCTCACAGGAGG -3'
(R):5'- GAGTCAGGATGTCTGTCATTGC -3'

Sequencing Primer
(F):5'- AGAACTCAGCTGGCGTGTG -3'
(R):5'- GGATGTCTGTCATTGCAGCCAC -3'
Posted On2014-06-23