Incidental Mutation 'R1797:Cpsf3'
ID202402
Institutional Source Beutler Lab
Gene Symbol Cpsf3
Ensembl Gene ENSMUSG00000054309
Gene Namecleavage and polyadenylation specificity factor 3
Synonyms73 kDa
MMRRC Submission 039827-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R1797 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location21285391-21315056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21306850 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 491 (N491K)
Ref Sequence ENSEMBL: ENSMUSP00000068148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067284] [ENSMUST00000222968]
Predicted Effect probably benign
Transcript: ENSMUST00000067284
AA Change: N491K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000068148
Gene: ENSMUSG00000054309
AA Change: N491K

DomainStartEndE-ValueType
Lactamase_B 24 234 8.27e-12 SMART
Beta-Casp 246 367 7.32e-45 SMART
Pfam:RMMBL 380 422 9.9e-17 PFAM
CPSF73-100_C 477 683 6.78e-81 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220940
Predicted Effect probably benign
Transcript: ENSMUST00000221042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221992
Predicted Effect probably benign
Transcript: ENSMUST00000222968
AA Change: I496N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallo-beta-lactamase family. The encoded protein is a 73kDa subunit of the cleavage and polyadenylation specificity factor and functions as an endonuclease that recognizes the pre-mRNA 3'-cleavage site AAUAAA prior to polyadenylation. It also cleaves after the pre-mRNA sequence ACCCA during histone 3'-end pre-mRNA processing. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,198,459 K200E possibly damaging Het
5830473C10Rik A T 5: 90,579,601 E359D probably damaging Het
Abcc2 A G 19: 43,814,786 E687G possibly damaging Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Abcg3 C T 5: 104,939,164 S534N possibly damaging Het
Acp1 A G 12: 30,896,114 probably null Het
Adam12 C A 7: 133,967,861 R295L probably benign Het
Alg1 C A 16: 5,239,143 H213Q probably benign Het
Ap4b1 T A 3: 103,818,833 W410R possibly damaging Het
As3mt A G 19: 46,724,934 T307A possibly damaging Het
Cdc14a T C 3: 116,322,194 I289V probably damaging Het
Cdk17 A G 10: 93,208,252 I18V possibly damaging Het
Cep131 C T 11: 120,073,736 probably null Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Cnih2 T C 19: 5,094,286 K66E probably benign Het
Cux1 C T 5: 136,275,315 E1253K probably benign Het
Dcc A C 18: 71,367,161 L1005R probably damaging Het
Ddx19b A T 8: 111,012,807 M200K probably damaging Het
Ech1 A G 7: 28,831,863 Y292C probably damaging Het
Edc4 G T 8: 105,891,085 A1121S probably benign Het
Eml6 T A 11: 29,882,041 I210F probably benign Het
Fam135b T C 15: 71,452,441 T1226A probably benign Het
Flg2 C T 3: 93,200,976 R104C probably damaging Het
Frzb T C 2: 80,446,528 I105V possibly damaging Het
Gli3 A G 13: 15,713,512 D504G probably damaging Het
Gm42669 A T 5: 107,507,817 K1161* probably null Het
Gm6665 T C 18: 31,820,133 E63G possibly damaging Het
Gm9923 T C 10: 72,309,763 V148A probably benign Het
Hoxc5 T C 15: 103,014,434 I118T probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Impdh1 T A 6: 29,207,169 I59F probably damaging Het
Iqch G A 9: 63,588,377 P111S possibly damaging Het
Itih1 G T 14: 30,929,899 Q829K probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kmt5b G T 19: 3,814,833 E632D probably benign Het
L2hgdh C T 12: 69,699,566 M373I probably benign Het
Map3k4 C T 17: 12,264,019 E604K probably benign Het
Mok T A 12: 110,808,045 Y420F probably benign Het
Nedd1 G A 10: 92,698,739 T303I possibly damaging Het
Nipal4 T A 11: 46,151,333 M174L probably benign Het
Olfr806 A C 10: 129,738,709 I69M probably benign Het
Pag1 T A 3: 9,693,886 T391S probably benign Het
Palm3 A G 8: 84,028,803 R315G probably benign Het
Patj C T 4: 98,687,438 R1177W probably damaging Het
Pbld2 G A 10: 63,075,124 probably null Het
Phldb1 A T 9: 44,716,545 M81K probably damaging Het
Pkn2 A G 3: 142,809,528 F682L probably damaging Het
Plce1 T C 19: 38,758,948 probably null Het
Plekha8 T A 6: 54,640,974 V518E probably damaging Het
Ppp1r3a T A 6: 14,717,982 M978L probably benign Het
Ppp4r4 T A 12: 103,598,151 C592S possibly damaging Het
Prdx6b T A 2: 80,293,202 D118E possibly damaging Het
Ptprg T C 14: 12,199,743 V52A probably damaging Het
Rab27b A G 18: 69,989,546 M114T probably damaging Het
Ralgps1 A G 2: 33,340,711 probably null Het
Rasa3 G A 8: 13,582,372 P506L probably benign Het
Rps6kb1 G A 11: 86,502,808 R499* probably null Het
S1pr4 A G 10: 81,499,190 M150T probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpina1e T C 12: 103,950,891 K173R probably benign Het
Serpina3m T A 12: 104,389,515 I147N probably damaging Het
Sh3rf3 G T 10: 59,086,667 G522* probably null Het
Smad1 A T 8: 79,343,844 V355E probably damaging Het
Srsf11 A G 3: 158,019,428 V211A possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stt3a C T 9: 36,743,415 probably null Het
Syne2 T C 12: 75,963,783 V2488A probably benign Het
Tbc1d23 T C 16: 57,173,100 T568A possibly damaging Het
Tnn A C 1: 160,140,688 V378G probably damaging Het
Trim50 T C 5: 135,353,501 V69A possibly damaging Het
Ttll10 A T 4: 156,047,567 D19E probably damaging Het
Ushbp1 G A 8: 71,388,923 R421C probably damaging Het
Vmn2r2 T C 3: 64,134,707 T196A probably benign Het
Wdr64 G A 1: 175,812,019 S1028N probably damaging Het
Wwtr1 T C 3: 57,462,575 Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 K216* probably null Het
Zfp39 T C 11: 58,900,660 D67G probably damaging Het
Zfp40 A G 17: 23,175,540 I691T possibly damaging Het
Zfp532 T C 18: 65,625,144 V716A probably benign Het
Zfp616 T A 11: 74,085,279 C791* probably null Het
Zfp932 G A 5: 109,996,623 probably benign Het
Other mutations in Cpsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Cpsf3 APN 12 21301456 missense probably damaging 1.00
IGL02192:Cpsf3 APN 12 21310193 unclassified probably benign
IGL02192:Cpsf3 APN 12 21310196 critical splice acceptor site probably null
IGL02651:Cpsf3 APN 12 21293297 missense probably damaging 1.00
IGL02963:Cpsf3 APN 12 21302422 missense probably damaging 0.99
IGL03072:Cpsf3 APN 12 21295088 missense possibly damaging 0.83
IGL03307:Cpsf3 APN 12 21296714 missense possibly damaging 0.87
IGL03335:Cpsf3 APN 12 21306887 splice site probably null
R0419:Cpsf3 UTSW 12 21297799 missense probably damaging 1.00
R0441:Cpsf3 UTSW 12 21300084 missense probably damaging 1.00
R1669:Cpsf3 UTSW 12 21305331 missense probably damaging 1.00
R1801:Cpsf3 UTSW 12 21313790 missense probably benign 0.01
R1860:Cpsf3 UTSW 12 21296732 missense probably damaging 1.00
R3782:Cpsf3 UTSW 12 21300066 missense possibly damaging 0.83
R3953:Cpsf3 UTSW 12 21313805 missense probably benign
R3954:Cpsf3 UTSW 12 21313805 missense probably benign
R3955:Cpsf3 UTSW 12 21313805 missense probably benign
R3957:Cpsf3 UTSW 12 21313805 missense probably benign
R4922:Cpsf3 UTSW 12 21301537 missense probably damaging 1.00
R5112:Cpsf3 UTSW 12 21291784 missense probably benign
R5363:Cpsf3 UTSW 12 21308985 missense probably benign 0.00
R5507:Cpsf3 UTSW 12 21297928 missense probably damaging 1.00
R6090:Cpsf3 UTSW 12 21295193 missense probably damaging 0.99
R6144:Cpsf3 UTSW 12 21306886 splice site probably null
R6238:Cpsf3 UTSW 12 21300162 missense probably damaging 1.00
R7229:Cpsf3 UTSW 12 21296737 critical splice donor site probably null
X0060:Cpsf3 UTSW 12 21302392 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGTGCTCTTCCCCATCAC -3'
(R):5'- AAGTATGCTGTGACCCCTTTCC -3'

Sequencing Primer
(F):5'- TAAGTGATACACTCCCCCGTGG -3'
(R):5'- GTGACCCCTTTCCTTCACAAAATAC -3'
Posted On2014-06-23