Incidental Mutation 'R1797:L2hgdh'
ID202404
Institutional Source Beutler Lab
Gene Symbol L2hgdh
Ensembl Gene ENSMUSG00000020988
Gene NameL-2-hydroxyglutarate dehydrogenase
Synonyms
MMRRC Submission 039827-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R1797 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69690433-69724873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69699566 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 373 (M373I)
Ref Sequence ENSEMBL: ENSMUSP00000021370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021370]
Predicted Effect probably benign
Transcript: ENSMUST00000021370
AA Change: M373I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021370
Gene: ENSMUSG00000020988
AA Change: M373I

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:DAO 51 457 1.9e-72 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes L-2-hydroxyglutarate dehydrogenase, a FAD-dependent enzyme that oxidizes L-2-hydroxyglutarate to alpha-ketoglutarate in a variety of mammalian tissues. Mutations in this gene cause L-2-hydroxyglutaric aciduria, a rare autosomal recessive neurometabolic disorder resulting in moderate to severe mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit increased levels of lysine and arginine associated with decreases in saccharopine, glutamine, and glutamate in adult brains, neurobehavioral deficits, and brain spongiosis with vacuolar lesions mostly affecting oligodendrocytes and myelin sheaths. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,198,459 K200E possibly damaging Het
5830473C10Rik A T 5: 90,579,601 E359D probably damaging Het
Abcc2 A G 19: 43,814,786 E687G possibly damaging Het
Abcc2 A T 19: 43,833,987 Q1421H probably damaging Het
Abcg3 C T 5: 104,939,164 S534N possibly damaging Het
Acp1 A G 12: 30,896,114 probably null Het
Adam12 C A 7: 133,967,861 R295L probably benign Het
Alg1 C A 16: 5,239,143 H213Q probably benign Het
Ap4b1 T A 3: 103,818,833 W410R possibly damaging Het
As3mt A G 19: 46,724,934 T307A possibly damaging Het
Cdc14a T C 3: 116,322,194 I289V probably damaging Het
Cdk17 A G 10: 93,208,252 I18V possibly damaging Het
Cep131 C T 11: 120,073,736 probably null Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Cnih2 T C 19: 5,094,286 K66E probably benign Het
Cpsf3 T A 12: 21,306,850 N491K probably benign Het
Cux1 C T 5: 136,275,315 E1253K probably benign Het
Dcc A C 18: 71,367,161 L1005R probably damaging Het
Ddx19b A T 8: 111,012,807 M200K probably damaging Het
Ech1 A G 7: 28,831,863 Y292C probably damaging Het
Edc4 G T 8: 105,891,085 A1121S probably benign Het
Eml6 T A 11: 29,882,041 I210F probably benign Het
Fam135b T C 15: 71,452,441 T1226A probably benign Het
Flg2 C T 3: 93,200,976 R104C probably damaging Het
Frzb T C 2: 80,446,528 I105V possibly damaging Het
Gli3 A G 13: 15,713,512 D504G probably damaging Het
Gm42669 A T 5: 107,507,817 K1161* probably null Het
Gm6665 T C 18: 31,820,133 E63G possibly damaging Het
Gm9923 T C 10: 72,309,763 V148A probably benign Het
Hoxc5 T C 15: 103,014,434 I118T probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Impdh1 T A 6: 29,207,169 I59F probably damaging Het
Iqch G A 9: 63,588,377 P111S possibly damaging Het
Itih1 G T 14: 30,929,899 Q829K probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Kmt5b G T 19: 3,814,833 E632D probably benign Het
Map3k4 C T 17: 12,264,019 E604K probably benign Het
Mok T A 12: 110,808,045 Y420F probably benign Het
Nedd1 G A 10: 92,698,739 T303I possibly damaging Het
Nipal4 T A 11: 46,151,333 M174L probably benign Het
Olfr806 A C 10: 129,738,709 I69M probably benign Het
Pag1 T A 3: 9,693,886 T391S probably benign Het
Palm3 A G 8: 84,028,803 R315G probably benign Het
Patj C T 4: 98,687,438 R1177W probably damaging Het
Pbld2 G A 10: 63,075,124 probably null Het
Phldb1 A T 9: 44,716,545 M81K probably damaging Het
Pkn2 A G 3: 142,809,528 F682L probably damaging Het
Plce1 T C 19: 38,758,948 probably null Het
Plekha8 T A 6: 54,640,974 V518E probably damaging Het
Ppp1r3a T A 6: 14,717,982 M978L probably benign Het
Ppp4r4 T A 12: 103,598,151 C592S possibly damaging Het
Prdx6b T A 2: 80,293,202 D118E possibly damaging Het
Ptprg T C 14: 12,199,743 V52A probably damaging Het
Rab27b A G 18: 69,989,546 M114T probably damaging Het
Ralgps1 A G 2: 33,340,711 probably null Het
Rasa3 G A 8: 13,582,372 P506L probably benign Het
Rps6kb1 G A 11: 86,502,808 R499* probably null Het
S1pr4 A G 10: 81,499,190 M150T probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpina1e T C 12: 103,950,891 K173R probably benign Het
Serpina3m T A 12: 104,389,515 I147N probably damaging Het
Sh3rf3 G T 10: 59,086,667 G522* probably null Het
Smad1 A T 8: 79,343,844 V355E probably damaging Het
Srsf11 A G 3: 158,019,428 V211A possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stt3a C T 9: 36,743,415 probably null Het
Syne2 T C 12: 75,963,783 V2488A probably benign Het
Tbc1d23 T C 16: 57,173,100 T568A possibly damaging Het
Tnn A C 1: 160,140,688 V378G probably damaging Het
Trim50 T C 5: 135,353,501 V69A possibly damaging Het
Ttll10 A T 4: 156,047,567 D19E probably damaging Het
Ushbp1 G A 8: 71,388,923 R421C probably damaging Het
Vmn2r2 T C 3: 64,134,707 T196A probably benign Het
Wdr64 G A 1: 175,812,019 S1028N probably damaging Het
Wwtr1 T C 3: 57,462,575 Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 K216* probably null Het
Zfp39 T C 11: 58,900,660 D67G probably damaging Het
Zfp40 A G 17: 23,175,540 I691T possibly damaging Het
Zfp532 T C 18: 65,625,144 V716A probably benign Het
Zfp616 T A 11: 74,085,279 C791* probably null Het
Zfp932 G A 5: 109,996,623 probably benign Het
Other mutations in L2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:L2hgdh APN 12 69701434 missense possibly damaging 0.67
IGL01505:L2hgdh APN 12 69721401 missense probably damaging 1.00
IGL01871:L2hgdh APN 12 69722095 missense probably damaging 1.00
IGL02169:L2hgdh APN 12 69721397 missense probably damaging 1.00
IGL02253:L2hgdh APN 12 69705760 splice site probably benign
IGL02670:L2hgdh APN 12 69692480 missense possibly damaging 0.86
IGL03069:L2hgdh APN 12 69692399 missense probably benign
R0054:L2hgdh UTSW 12 69721331 missense possibly damaging 0.82
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0579:L2hgdh UTSW 12 69701272 splice site probably benign
R1421:L2hgdh UTSW 12 69701318 missense probably benign
R3082:L2hgdh UTSW 12 69722084 missense probably benign 0.00
R7640:L2hgdh UTSW 12 69721357 nonsense probably null
Z1176:L2hgdh UTSW 12 69707132 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGAGGGATGCTAGCCTCTTGG -3'
(R):5'- ACCATTCTGAAGTCGAGTTCC -3'

Sequencing Primer
(F):5'- TGCTAGCCTCTTGGGAAAAAG -3'
(R):5'- AGTGAATTCCTCTCCTTATATTAGCC -3'
Posted On2014-06-23