Incidental Mutation 'R1797:Gli3'
ID 202410
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 039827-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1797 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15888097 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 504 (D504G)
Ref Sequence ENSEMBL: ENSMUSP00000115989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065]
AlphaFold Q61602
Predicted Effect possibly damaging
Transcript: ENSMUST00000110510
AA Change: D504G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: D504G

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130065
AA Change: D504G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: D504G

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,089,285 (GRCm39) K200E possibly damaging Het
Abcc2 A G 19: 43,803,225 (GRCm39) E687G possibly damaging Het
Abcc2 A T 19: 43,822,426 (GRCm39) Q1421H probably damaging Het
Abcg3 C T 5: 105,087,030 (GRCm39) S534N possibly damaging Het
Acp1 A G 12: 30,946,113 (GRCm39) probably null Het
Adam12 C A 7: 133,569,590 (GRCm39) R295L probably benign Het
Albfm1 A T 5: 90,727,460 (GRCm39) E359D probably damaging Het
Alg1 C A 16: 5,057,007 (GRCm39) H213Q probably benign Het
Ap4b1 T A 3: 103,726,149 (GRCm39) W410R possibly damaging Het
As3mt A G 19: 46,713,373 (GRCm39) T307A possibly damaging Het
Cdc14a T C 3: 116,115,843 (GRCm39) I289V probably damaging Het
Cdk17 A G 10: 93,044,114 (GRCm39) I18V possibly damaging Het
Cep131 C T 11: 119,964,562 (GRCm39) probably null Het
Clca3a2 A G 3: 144,503,398 (GRCm39) Y851H probably benign Het
Cnih2 T C 19: 5,144,314 (GRCm39) K66E probably benign Het
Cpsf3 T A 12: 21,356,851 (GRCm39) N491K probably benign Het
Cux1 C T 5: 136,304,169 (GRCm39) E1253K probably benign Het
Dcc A C 18: 71,500,232 (GRCm39) L1005R probably damaging Het
Ddx19b A T 8: 111,739,439 (GRCm39) M200K probably damaging Het
Ech1 A G 7: 28,531,288 (GRCm39) Y292C probably damaging Het
Edc4 G T 8: 106,617,717 (GRCm39) A1121S probably benign Het
Eml6 T A 11: 29,832,041 (GRCm39) I210F probably benign Het
Fam135b T C 15: 71,324,290 (GRCm39) T1226A probably benign Het
Flg2 C T 3: 93,108,283 (GRCm39) R104C probably damaging Het
Frzb T C 2: 80,276,872 (GRCm39) I105V possibly damaging Het
Gm42669 A T 5: 107,655,683 (GRCm39) K1161* probably null Het
Gm6665 T C 18: 31,953,186 (GRCm39) E63G possibly damaging Het
Gm9923 T C 10: 72,145,593 (GRCm39) V148A probably benign Het
Hoxc5 T C 15: 102,922,866 (GRCm39) I118T probably benign Het
Hsp90b1 A G 10: 86,537,609 (GRCm39) V232A possibly damaging Het
Impdh1 T A 6: 29,207,168 (GRCm39) I59F probably damaging Het
Iqch G A 9: 63,495,659 (GRCm39) P111S possibly damaging Het
Itih1 G T 14: 30,651,856 (GRCm39) Q829K probably damaging Het
Kcnh2 C T 5: 24,527,670 (GRCm39) R894H probably damaging Het
Kmt5b G T 19: 3,864,833 (GRCm39) E632D probably benign Het
L2hgdh C T 12: 69,746,340 (GRCm39) M373I probably benign Het
Map3k4 C T 17: 12,482,906 (GRCm39) E604K probably benign Het
Mok T A 12: 110,774,479 (GRCm39) Y420F probably benign Het
Nedd1 G A 10: 92,534,601 (GRCm39) T303I possibly damaging Het
Nipal4 T A 11: 46,042,160 (GRCm39) M174L probably benign Het
Or6c213 A C 10: 129,574,578 (GRCm39) I69M probably benign Het
Pag1 T A 3: 9,758,946 (GRCm39) T391S probably benign Het
Palm3 A G 8: 84,755,432 (GRCm39) R315G probably benign Het
Patj C T 4: 98,575,675 (GRCm39) R1177W probably damaging Het
Pbld2 G A 10: 62,910,903 (GRCm39) probably null Het
Phldb1 A T 9: 44,627,842 (GRCm39) M81K probably damaging Het
Pkn2 A G 3: 142,515,289 (GRCm39) F682L probably damaging Het
Plce1 T C 19: 38,747,392 (GRCm39) probably null Het
Plekha8 T A 6: 54,617,959 (GRCm39) V518E probably damaging Het
Ppp1r3a T A 6: 14,717,981 (GRCm39) M978L probably benign Het
Ppp4r4 T A 12: 103,564,410 (GRCm39) C592S possibly damaging Het
Prdx6b T A 2: 80,123,546 (GRCm39) D118E possibly damaging Het
Ptprg T C 14: 12,199,743 (GRCm38) V52A probably damaging Het
Rab27b A G 18: 70,122,617 (GRCm39) M114T probably damaging Het
Ralgps1 A G 2: 33,230,723 (GRCm39) probably null Het
Rasa3 G A 8: 13,632,372 (GRCm39) P506L probably benign Het
Rps6kb1 G A 11: 86,393,634 (GRCm39) R499* probably null Het
S1pr4 A G 10: 81,335,024 (GRCm39) M150T probably damaging Het
Scube2 T C 7: 109,430,882 (GRCm39) D439G probably damaging Het
Serpina1e T C 12: 103,917,150 (GRCm39) K173R probably benign Het
Serpina3m T A 12: 104,355,774 (GRCm39) I147N probably damaging Het
Sh3rf3 G T 10: 58,922,489 (GRCm39) G522* probably null Het
Smad1 A T 8: 80,070,473 (GRCm39) V355E probably damaging Het
Srsf11 A G 3: 157,725,065 (GRCm39) V211A possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stt3a C T 9: 36,654,711 (GRCm39) probably null Het
Syne2 T C 12: 76,010,557 (GRCm39) V2488A probably benign Het
Tbc1d23 T C 16: 56,993,463 (GRCm39) T568A possibly damaging Het
Tnn A C 1: 159,968,258 (GRCm39) V378G probably damaging Het
Trim50 T C 5: 135,382,355 (GRCm39) V69A possibly damaging Het
Ttll10 A T 4: 156,132,024 (GRCm39) D19E probably damaging Het
Ushbp1 G A 8: 71,841,567 (GRCm39) R421C probably damaging Het
Vmn2r2 T C 3: 64,042,128 (GRCm39) T196A probably benign Het
Wdr64 G A 1: 175,639,585 (GRCm39) S1028N probably damaging Het
Wwtr1 T C 3: 57,369,996 (GRCm39) Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 (GRCm39) K216* probably null Het
Zfp39 T C 11: 58,791,486 (GRCm39) D67G probably damaging Het
Zfp40 A G 17: 23,394,514 (GRCm39) I691T possibly damaging Het
Zfp532 T C 18: 65,758,215 (GRCm39) V716A probably benign Het
Zfp616 T A 11: 73,976,105 (GRCm39) C791* probably null Het
Zfp932 G A 5: 110,144,489 (GRCm39) probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCAGGCAGTTACCAACAG -3'
(R):5'- GCCTAGAGAGCAAAGTGTCAC -3'

Sequencing Primer
(F):5'- GCTCAAATTTGAGCATTTTCAC -3'
(R):5'- CTAGAGAGCAAAGTGTCACACTCG -3'
Posted On 2014-06-23