Incidental Mutation 'R1797:Abcc2'
ID 202431
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family member 2
Synonyms Cmoat, Mrp2, multidrug resistance protein 2
MMRRC Submission 039827-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1797 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 43770747-43826771 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43803225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 687 (E687G)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect possibly damaging
Transcript: ENSMUST00000026208
AA Change: E687G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: E687G

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146737
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,089,285 (GRCm39) K200E possibly damaging Het
Abcg3 C T 5: 105,087,030 (GRCm39) S534N possibly damaging Het
Acp1 A G 12: 30,946,113 (GRCm39) probably null Het
Adam12 C A 7: 133,569,590 (GRCm39) R295L probably benign Het
Albfm1 A T 5: 90,727,460 (GRCm39) E359D probably damaging Het
Alg1 C A 16: 5,057,007 (GRCm39) H213Q probably benign Het
Ap4b1 T A 3: 103,726,149 (GRCm39) W410R possibly damaging Het
As3mt A G 19: 46,713,373 (GRCm39) T307A possibly damaging Het
Cdc14a T C 3: 116,115,843 (GRCm39) I289V probably damaging Het
Cdk17 A G 10: 93,044,114 (GRCm39) I18V possibly damaging Het
Cep131 C T 11: 119,964,562 (GRCm39) probably null Het
Clca3a2 A G 3: 144,503,398 (GRCm39) Y851H probably benign Het
Cnih2 T C 19: 5,144,314 (GRCm39) K66E probably benign Het
Cpsf3 T A 12: 21,356,851 (GRCm39) N491K probably benign Het
Cux1 C T 5: 136,304,169 (GRCm39) E1253K probably benign Het
Dcc A C 18: 71,500,232 (GRCm39) L1005R probably damaging Het
Ddx19b A T 8: 111,739,439 (GRCm39) M200K probably damaging Het
Ech1 A G 7: 28,531,288 (GRCm39) Y292C probably damaging Het
Edc4 G T 8: 106,617,717 (GRCm39) A1121S probably benign Het
Eml6 T A 11: 29,832,041 (GRCm39) I210F probably benign Het
Fam135b T C 15: 71,324,290 (GRCm39) T1226A probably benign Het
Flg2 C T 3: 93,108,283 (GRCm39) R104C probably damaging Het
Frzb T C 2: 80,276,872 (GRCm39) I105V possibly damaging Het
Gli3 A G 13: 15,888,097 (GRCm39) D504G probably damaging Het
Gm42669 A T 5: 107,655,683 (GRCm39) K1161* probably null Het
Gm6665 T C 18: 31,953,186 (GRCm39) E63G possibly damaging Het
Gm9923 T C 10: 72,145,593 (GRCm39) V148A probably benign Het
Hoxc5 T C 15: 102,922,866 (GRCm39) I118T probably benign Het
Hsp90b1 A G 10: 86,537,609 (GRCm39) V232A possibly damaging Het
Impdh1 T A 6: 29,207,168 (GRCm39) I59F probably damaging Het
Iqch G A 9: 63,495,659 (GRCm39) P111S possibly damaging Het
Itih1 G T 14: 30,651,856 (GRCm39) Q829K probably damaging Het
Kcnh2 C T 5: 24,527,670 (GRCm39) R894H probably damaging Het
Kmt5b G T 19: 3,864,833 (GRCm39) E632D probably benign Het
L2hgdh C T 12: 69,746,340 (GRCm39) M373I probably benign Het
Map3k4 C T 17: 12,482,906 (GRCm39) E604K probably benign Het
Mok T A 12: 110,774,479 (GRCm39) Y420F probably benign Het
Nedd1 G A 10: 92,534,601 (GRCm39) T303I possibly damaging Het
Nipal4 T A 11: 46,042,160 (GRCm39) M174L probably benign Het
Or6c213 A C 10: 129,574,578 (GRCm39) I69M probably benign Het
Pag1 T A 3: 9,758,946 (GRCm39) T391S probably benign Het
Palm3 A G 8: 84,755,432 (GRCm39) R315G probably benign Het
Patj C T 4: 98,575,675 (GRCm39) R1177W probably damaging Het
Pbld2 G A 10: 62,910,903 (GRCm39) probably null Het
Phldb1 A T 9: 44,627,842 (GRCm39) M81K probably damaging Het
Pkn2 A G 3: 142,515,289 (GRCm39) F682L probably damaging Het
Plce1 T C 19: 38,747,392 (GRCm39) probably null Het
Plekha8 T A 6: 54,617,959 (GRCm39) V518E probably damaging Het
Ppp1r3a T A 6: 14,717,981 (GRCm39) M978L probably benign Het
Ppp4r4 T A 12: 103,564,410 (GRCm39) C592S possibly damaging Het
Prdx6b T A 2: 80,123,546 (GRCm39) D118E possibly damaging Het
Ptprg T C 14: 12,199,743 (GRCm38) V52A probably damaging Het
Rab27b A G 18: 70,122,617 (GRCm39) M114T probably damaging Het
Ralgps1 A G 2: 33,230,723 (GRCm39) probably null Het
Rasa3 G A 8: 13,632,372 (GRCm39) P506L probably benign Het
Rps6kb1 G A 11: 86,393,634 (GRCm39) R499* probably null Het
S1pr4 A G 10: 81,335,024 (GRCm39) M150T probably damaging Het
Scube2 T C 7: 109,430,882 (GRCm39) D439G probably damaging Het
Serpina1e T C 12: 103,917,150 (GRCm39) K173R probably benign Het
Serpina3m T A 12: 104,355,774 (GRCm39) I147N probably damaging Het
Sh3rf3 G T 10: 58,922,489 (GRCm39) G522* probably null Het
Smad1 A T 8: 80,070,473 (GRCm39) V355E probably damaging Het
Srsf11 A G 3: 157,725,065 (GRCm39) V211A possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stt3a C T 9: 36,654,711 (GRCm39) probably null Het
Syne2 T C 12: 76,010,557 (GRCm39) V2488A probably benign Het
Tbc1d23 T C 16: 56,993,463 (GRCm39) T568A possibly damaging Het
Tnn A C 1: 159,968,258 (GRCm39) V378G probably damaging Het
Trim50 T C 5: 135,382,355 (GRCm39) V69A possibly damaging Het
Ttll10 A T 4: 156,132,024 (GRCm39) D19E probably damaging Het
Ushbp1 G A 8: 71,841,567 (GRCm39) R421C probably damaging Het
Vmn2r2 T C 3: 64,042,128 (GRCm39) T196A probably benign Het
Wdr64 G A 1: 175,639,585 (GRCm39) S1028N probably damaging Het
Wwtr1 T C 3: 57,369,996 (GRCm39) Y373C probably damaging Het
Zeb1 A T 18: 5,766,298 (GRCm39) K216* probably null Het
Zfp39 T C 11: 58,791,486 (GRCm39) D67G probably damaging Het
Zfp40 A G 17: 23,394,514 (GRCm39) I691T possibly damaging Het
Zfp532 T C 18: 65,758,215 (GRCm39) V716A probably benign Het
Zfp616 T A 11: 73,976,105 (GRCm39) C791* probably null Het
Zfp932 G A 5: 110,144,489 (GRCm39) probably benign Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43,772,641 (GRCm39) missense probably benign 0.39
IGL01611:Abcc2 APN 19 43,815,068 (GRCm39) missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43,772,734 (GRCm39) missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43,810,189 (GRCm39) splice site probably benign
IGL02041:Abcc2 APN 19 43,772,674 (GRCm39) missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43,786,943 (GRCm39) missense probably benign
IGL02950:Abcc2 APN 19 43,814,406 (GRCm39) missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43,770,841 (GRCm39) utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43,772,743 (GRCm39) missense probably benign 0.00
loser UTSW 19 43,827,850 (GRCm39) utr 3 prime probably benign
nelson UTSW 19 43,792,178 (GRCm39) missense probably benign 0.07
Sore UTSW 19 43,786,633 (GRCm39) missense probably benign 0.22
BB002:Abcc2 UTSW 19 43,795,551 (GRCm39) missense probably benign 0.07
BB012:Abcc2 UTSW 19 43,795,551 (GRCm39) missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43,792,221 (GRCm39) nonsense probably null
PIT4519001:Abcc2 UTSW 19 43,807,836 (GRCm39) missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43,815,053 (GRCm39) nonsense probably null
R0326:Abcc2 UTSW 19 43,814,386 (GRCm39) missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43,810,044 (GRCm39) splice site probably benign
R0558:Abcc2 UTSW 19 43,789,163 (GRCm39) missense probably benign 0.00
R0577:Abcc2 UTSW 19 43,807,840 (GRCm39) missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43,786,955 (GRCm39) critical splice donor site probably null
R1189:Abcc2 UTSW 19 43,807,852 (GRCm39) missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43,822,426 (GRCm39) missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43,822,379 (GRCm39) missense probably benign 0.22
R1606:Abcc2 UTSW 19 43,825,091 (GRCm39) missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43,786,858 (GRCm39) missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43,822,426 (GRCm39) missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43,810,453 (GRCm39) missense probably benign 0.01
R1882:Abcc2 UTSW 19 43,786,945 (GRCm39) missense probably benign 0.00
R1913:Abcc2 UTSW 19 43,795,683 (GRCm39) missense probably benign 0.10
R1986:Abcc2 UTSW 19 43,818,318 (GRCm39) missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43,795,581 (GRCm39) missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43,795,581 (GRCm39) missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43,793,500 (GRCm39) missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43,806,477 (GRCm39) missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43,786,885 (GRCm39) missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43,810,065 (GRCm39) missense probably benign 0.01
R4010:Abcc2 UTSW 19 43,818,303 (GRCm39) missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43,811,559 (GRCm39) missense probably benign
R4064:Abcc2 UTSW 19 43,793,432 (GRCm39) nonsense probably null
R4296:Abcc2 UTSW 19 43,811,514 (GRCm39) missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43,811,513 (GRCm39) missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43,787,575 (GRCm39) missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43,799,558 (GRCm39) missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43,792,178 (GRCm39) missense probably benign 0.07
R4631:Abcc2 UTSW 19 43,803,146 (GRCm39) missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43,789,157 (GRCm39) missense probably benign
R4715:Abcc2 UTSW 19 43,805,321 (GRCm39) missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43,820,553 (GRCm39) missense probably benign 0.23
R4760:Abcc2 UTSW 19 43,798,920 (GRCm39) missense probably benign 0.03
R4801:Abcc2 UTSW 19 43,807,800 (GRCm39) missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43,807,800 (GRCm39) missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43,789,074 (GRCm39) missense probably benign 0.34
R5143:Abcc2 UTSW 19 43,810,100 (GRCm39) missense probably benign 0.28
R5206:Abcc2 UTSW 19 43,806,589 (GRCm39) missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43,818,339 (GRCm39) missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43,827,904 (GRCm39) utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43,786,633 (GRCm39) missense probably benign 0.22
R5863:Abcc2 UTSW 19 43,786,575 (GRCm39) missense probably benign 0.00
R5928:Abcc2 UTSW 19 43,807,797 (GRCm39) missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43,801,629 (GRCm39) missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43,807,942 (GRCm39) missense probably benign
R6014:Abcc2 UTSW 19 43,815,174 (GRCm39) missense probably benign
R6419:Abcc2 UTSW 19 43,825,947 (GRCm39) splice site probably null
R6497:Abcc2 UTSW 19 43,793,544 (GRCm39) missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43,770,645 (GRCm39) splice site probably null
R6614:Abcc2 UTSW 19 43,807,800 (GRCm39) missense probably benign 0.01
R6649:Abcc2 UTSW 19 43,800,941 (GRCm39) missense probably benign 0.05
R6653:Abcc2 UTSW 19 43,800,941 (GRCm39) missense probably benign 0.05
R6670:Abcc2 UTSW 19 43,827,850 (GRCm39) utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43,786,515 (GRCm39) missense probably benign 0.12
R6989:Abcc2 UTSW 19 43,820,611 (GRCm39) missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43,786,617 (GRCm39) missense probably benign 0.03
R7026:Abcc2 UTSW 19 43,818,974 (GRCm39) missense probably benign 0.01
R7026:Abcc2 UTSW 19 43,805,392 (GRCm39) missense probably benign 0.00
R7136:Abcc2 UTSW 19 43,825,899 (GRCm39) missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43,816,388 (GRCm39) missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43,795,492 (GRCm39) missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43,797,126 (GRCm39) missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43,810,478 (GRCm39) missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43,815,032 (GRCm39) missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43,772,685 (GRCm39) missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43,818,866 (GRCm39) missense probably benign 0.01
R7911:Abcc2 UTSW 19 43,792,109 (GRCm39) missense probably benign 0.00
R7919:Abcc2 UTSW 19 43,805,248 (GRCm39) missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43,795,551 (GRCm39) missense probably benign 0.07
R7993:Abcc2 UTSW 19 43,803,231 (GRCm39) missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43,805,394 (GRCm39) missense probably benign 0.10
R8177:Abcc2 UTSW 19 43,795,519 (GRCm39) missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43,793,410 (GRCm39) missense probably benign 0.07
R8693:Abcc2 UTSW 19 43,810,474 (GRCm39) missense probably benign 0.06
R8722:Abcc2 UTSW 19 43,825,052 (GRCm39) missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43,770,855 (GRCm39) missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43,787,577 (GRCm39) missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43,787,577 (GRCm39) missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43,797,105 (GRCm39) missense probably benign 0.01
R8889:Abcc2 UTSW 19 43,795,571 (GRCm39) missense possibly damaging 0.88
R8892:Abcc2 UTSW 19 43,795,571 (GRCm39) missense possibly damaging 0.88
R8936:Abcc2 UTSW 19 43,797,101 (GRCm39) missense probably benign 0.35
R9031:Abcc2 UTSW 19 43,810,466 (GRCm39) missense probably benign
R9116:Abcc2 UTSW 19 43,793,391 (GRCm39) missense probably benign 0.30
R9201:Abcc2 UTSW 19 43,786,880 (GRCm39) missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43,786,882 (GRCm39) missense probably benign 0.01
R9345:Abcc2 UTSW 19 43,807,869 (GRCm39) missense probably damaging 0.97
R9487:Abcc2 UTSW 19 43,806,471 (GRCm39) missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43,820,644 (GRCm39) critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43,811,539 (GRCm39) nonsense probably null
Z1177:Abcc2 UTSW 19 43,792,175 (GRCm39) missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43,792,173 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTCAGAGAAATGCCTTGAACG -3'
(R):5'- AAGCCATCTCTAGTCAACGG -3'

Sequencing Primer
(F):5'- GAAATGCCTTGAACGACTGC -3'
(R):5'- ACCTGGTATGCGTGTACGAATCAC -3'
Posted On 2014-06-23