Mutagenetix > Incidental Mutations

Incidental Mutation 'R1797:Abcc2'

202432

Institutional Source

Beutler Lab

Gene Symbol

Abcc2

Ensembl Gene

ENSMUSG00000025194

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 2

Synonyms

multidrug resistance protein 2, Cmoat, Mrp2

MMRRC Submission

039827-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1797 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43782192-43840740 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43833987 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 1421 (Q1421H)

Ref Sequence

ENSEMBL: ENSMUSP00000026208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026208] [ENSMUST00000099413]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026208
AA Change: Q1421H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: Q1421H

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC
transmembrane domain	63	85	N/A	INTRINSIC
transmembrane domain	100	116	N/A	INTRINSIC
transmembrane domain	128	150	N/A	INTRINSIC
transmembrane domain	160	182	N/A	INTRINSIC
Pfam:ABC_membrane	319	591	3.4e-37	PFAM
low complexity region	597	608	N/A	INTRINSIC
AAA	661	836	1.77e-8	SMART
low complexity region	906	933	N/A	INTRINSIC
Pfam:ABC_membrane	977	1249	5.4e-48	PFAM
AAA	1324	1509	1.33e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099413

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	C	11: 72,198,459	K200E	possibly damaging	Het
5830473C10Rik	A	T	5: 90,579,601	E359D	probably damaging	Het
Abcg3	C	T	5: 104,939,164	S534N	possibly damaging	Het
Acp1	A	G	12: 30,896,114		probably null	Het
Adam12	C	A	7: 133,967,861	R295L	probably benign	Het
Alg1	C	A	16: 5,239,143	H213Q	probably benign	Het
Ap4b1	T	A	3: 103,818,833	W410R	possibly damaging	Het
As3mt	A	G	19: 46,724,934	T307A	possibly damaging	Het
Cdc14a	T	C	3: 116,322,194	I289V	probably damaging	Het
Cdk17	A	G	10: 93,208,252	I18V	possibly damaging	Het
Cep131	C	T	11: 120,073,736		probably null	Het
Clca3a2	A	G	3: 144,797,637	Y851H	probably benign	Het
Cnih2	T	C	19: 5,094,286	K66E	probably benign	Het
Cpsf3	T	A	12: 21,306,850	N491K	probably benign	Het
Cux1	C	T	5: 136,275,315	E1253K	probably benign	Het
Dcc	A	C	18: 71,367,161	L1005R	probably damaging	Het
Ddx19b	A	T	8: 111,012,807	M200K	probably damaging	Het
Ech1	A	G	7: 28,831,863	Y292C	probably damaging	Het
Edc4	G	T	8: 105,891,085	A1121S	probably benign	Het
Eml6	T	A	11: 29,882,041	I210F	probably benign	Het
Fam135b	T	C	15: 71,452,441	T1226A	probably benign	Het
Flg2	C	T	3: 93,200,976	R104C	probably damaging	Het
Frzb	T	C	2: 80,446,528	I105V	possibly damaging	Het
Gli3	A	G	13: 15,713,512	D504G	probably damaging	Het
Gm42669	A	T	5: 107,507,817	K1161*	probably null	Het
Gm6665	T	C	18: 31,820,133	E63G	possibly damaging	Het
Gm9923	T	C	10: 72,309,763	V148A	probably benign	Het
Hoxc5	T	C	15: 103,014,434	I118T	probably benign	Het
Hsp90b1	A	G	10: 86,701,745	V232A	possibly damaging	Het
Impdh1	T	A	6: 29,207,169	I59F	probably damaging	Het
Iqch	G	A	9: 63,588,377	P111S	possibly damaging	Het
Itih1	G	T	14: 30,929,899	Q829K	probably damaging	Het
Kcnh2	C	T	5: 24,322,672	R894H	probably damaging	Het
Kmt5b	G	T	19: 3,814,833	E632D	probably benign	Het
L2hgdh	C	T	12: 69,699,566	M373I	probably benign	Het
Map3k4	C	T	17: 12,264,019	E604K	probably benign	Het
Mok	T	A	12: 110,808,045	Y420F	probably benign	Het
Nedd1	G	A	10: 92,698,739	T303I	possibly damaging	Het
Nipal4	T	A	11: 46,151,333	M174L	probably benign	Het
Olfr806	A	C	10: 129,738,709	I69M	probably benign	Het
Pag1	T	A	3: 9,693,886	T391S	probably benign	Het
Palm3	A	G	8: 84,028,803	R315G	probably benign	Het
Patj	C	T	4: 98,687,438	R1177W	probably damaging	Het
Pbld2	G	A	10: 63,075,124		probably null	Het
Phldb1	A	T	9: 44,716,545	M81K	probably damaging	Het
Pkn2	A	G	3: 142,809,528	F682L	probably damaging	Het
Plce1	T	C	19: 38,758,948		probably null	Het
Plekha8	T	A	6: 54,640,974	V518E	probably damaging	Het
Ppp1r3a	T	A	6: 14,717,982	M978L	probably benign	Het
Ppp4r4	T	A	12: 103,598,151	C592S	possibly damaging	Het
Prdx6b	T	A	2: 80,293,202	D118E	possibly damaging	Het
Ptprg	T	C	14: 12,199,743	V52A	probably damaging	Het
Rab27b	A	G	18: 69,989,546	M114T	probably damaging	Het
Ralgps1	A	G	2: 33,340,711		probably null	Het
Rasa3	G	A	8: 13,582,372	P506L	probably benign	Het
Rps6kb1	G	A	11: 86,502,808	R499*	probably null	Het
S1pr4	A	G	10: 81,499,190	M150T	probably damaging	Het
Scube2	T	C	7: 109,831,675	D439G	probably damaging	Het
Serpina1e	T	C	12: 103,950,891	K173R	probably benign	Het
Serpina3m	T	A	12: 104,389,515	I147N	probably damaging	Het
Sh3rf3	G	T	10: 59,086,667	G522*	probably null	Het
Smad1	A	T	8: 79,343,844	V355E	probably damaging	Het
Srsf11	A	G	3: 158,019,428	V211A	possibly damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stt3a	C	T	9: 36,743,415		probably null	Het
Syne2	T	C	12: 75,963,783	V2488A	probably benign	Het
Tbc1d23	T	C	16: 57,173,100	T568A	possibly damaging	Het
Tnn	A	C	1: 160,140,688	V378G	probably damaging	Het
Trim50	T	C	5: 135,353,501	V69A	possibly damaging	Het
Ttll10	A	T	4: 156,047,567	D19E	probably damaging	Het
Ushbp1	G	A	8: 71,388,923	R421C	probably damaging	Het
Vmn2r2	T	C	3: 64,134,707	T196A	probably benign	Het
Wdr64	G	A	1: 175,812,019	S1028N	probably damaging	Het
Wwtr1	T	C	3: 57,462,575	Y373C	probably damaging	Het
Zeb1	A	T	18: 5,766,298	K216*	probably null	Het
Zfp39	T	C	11: 58,900,660	D67G	probably damaging	Het
Zfp40	A	G	17: 23,175,540	I691T	possibly damaging	Het
Zfp532	T	C	18: 65,625,144	V716A	probably benign	Het
Zfp616	T	A	11: 74,085,279	C791*	probably null	Het
Zfp932	G	A	5: 109,996,623		probably benign	Het

Other mutations in Abcc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Abcc2	APN	19	43784202	missense	probably benign	0.39
IGL01611:Abcc2	APN	19	43826629	missense	probably damaging	1.00
IGL01800:Abcc2	APN	19	43784295	missense	possibly damaging	0.78
IGL02008:Abcc2	APN	19	43821750	splice site	probably benign
IGL02041:Abcc2	APN	19	43784235	missense	probably damaging	1.00
IGL02528:Abcc2	APN	19	43798504	missense	probably benign
IGL02950:Abcc2	APN	19	43825967	missense	possibly damaging	0.83
IGL03081:Abcc2	APN	19	43782402	utr 5 prime	probably benign
IGL03397:Abcc2	APN	19	43784304	missense	probably benign	0.00
loser	UTSW	19	43839411	utr 3 prime	probably benign
nelson	UTSW	19	43803739	missense	probably benign	0.07
Sore	UTSW	19	43798194	missense	probably benign	0.22
BB002:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
BB012:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
PIT4453001:Abcc2	UTSW	19	43803782	nonsense	probably null
PIT4519001:Abcc2	UTSW	19	43819397	missense	possibly damaging	0.81
R0197:Abcc2	UTSW	19	43826614	nonsense	probably null
R0326:Abcc2	UTSW	19	43825947	missense	possibly damaging	0.90
R0391:Abcc2	UTSW	19	43821605	splice site	probably benign
R0558:Abcc2	UTSW	19	43800724	missense	probably benign	0.00
R0577:Abcc2	UTSW	19	43819401	missense	probably damaging	1.00
R0787:Abcc2	UTSW	19	43798516	critical splice donor site	probably null
R1189:Abcc2	UTSW	19	43819413	missense	probably damaging	1.00
R1200:Abcc2	UTSW	19	43833987	missense	probably damaging	0.98
R1395:Abcc2	UTSW	19	43833940	missense	probably benign	0.22
R1606:Abcc2	UTSW	19	43836652	missense	probably damaging	1.00
R1775:Abcc2	UTSW	19	43798419	missense	possibly damaging	0.88
R1797:Abcc2	UTSW	19	43814786	missense	possibly damaging	0.81
R1826:Abcc2	UTSW	19	43822014	missense	probably benign	0.01
R1882:Abcc2	UTSW	19	43798506	missense	probably benign	0.00
R1913:Abcc2	UTSW	19	43807244	missense	probably benign	0.10
R1986:Abcc2	UTSW	19	43829879	missense	probably damaging	1.00
R1991:Abcc2	UTSW	19	43807142	missense	probably damaging	1.00
R1992:Abcc2	UTSW	19	43807142	missense	probably damaging	1.00
R2006:Abcc2	UTSW	19	43805061	missense	probably damaging	1.00
R2057:Abcc2	UTSW	19	43818038	missense	probably damaging	1.00
R3709:Abcc2	UTSW	19	43798446	missense	possibly damaging	0.80
R3802:Abcc2	UTSW	19	43821626	missense	probably benign	0.01
R4010:Abcc2	UTSW	19	43829864	missense	possibly damaging	0.75
R4014:Abcc2	UTSW	19	43823120	missense	probably benign
R4064:Abcc2	UTSW	19	43804993	nonsense	probably null
R4296:Abcc2	UTSW	19	43823074	missense	probably damaging	1.00
R4296:Abcc2	UTSW	19	43823075	missense	probably damaging	1.00
R4363:Abcc2	UTSW	19	43799136	missense	possibly damaging	0.94
R4580:Abcc2	UTSW	19	43811119	missense	probably damaging	1.00
R4625:Abcc2	UTSW	19	43803739	missense	probably benign	0.07
R4631:Abcc2	UTSW	19	43814707	missense	possibly damaging	0.70
R4671:Abcc2	UTSW	19	43800718	missense	probably benign
R4715:Abcc2	UTSW	19	43816882	missense	possibly damaging	0.54
R4726:Abcc2	UTSW	19	43832114	missense	probably benign	0.23
R4760:Abcc2	UTSW	19	43810481	missense	probably benign	0.03
R4801:Abcc2	UTSW	19	43819361	missense	probably damaging	1.00
R4802:Abcc2	UTSW	19	43819361	missense	probably damaging	1.00
R4976:Abcc2	UTSW	19	43800635	missense	probably benign	0.34
R5143:Abcc2	UTSW	19	43821661	missense	probably benign	0.28
R5206:Abcc2	UTSW	19	43818150	missense	probably damaging	1.00
R5376:Abcc2	UTSW	19	43829900	missense	possibly damaging	0.76
R5478:Abcc2	UTSW	19	43839465	utr 3 prime	probably benign
R5700:Abcc2	UTSW	19	43798194	missense	probably benign	0.22
R5863:Abcc2	UTSW	19	43798136	missense	probably benign	0.00
R5928:Abcc2	UTSW	19	43819358	missense	probably damaging	1.00
R5955:Abcc2	UTSW	19	43813190	missense	probably damaging	0.98
R5983:Abcc2	UTSW	19	43819503	missense	probably benign
R6014:Abcc2	UTSW	19	43826735	missense	probably benign
R6419:Abcc2	UTSW	19	43837508	splice site	probably null
R6497:Abcc2	UTSW	19	43805105	missense	probably damaging	1.00
R6510:Abcc2	UTSW	19	43782206	splice site	probably null
R6614:Abcc2	UTSW	19	43819361	missense	probably benign	0.01
R6649:Abcc2	UTSW	19	43812502	missense	probably benign	0.05
R6653:Abcc2	UTSW	19	43812502	missense	probably benign	0.05
R6670:Abcc2	UTSW	19	43839411	utr 3 prime	probably benign
R6964:Abcc2	UTSW	19	43798076	missense	probably benign	0.12
R6989:Abcc2	UTSW	19	43832172	missense	probably damaging	1.00
R7015:Abcc2	UTSW	19	43798178	missense	probably benign	0.03
R7026:Abcc2	UTSW	19	43816953	missense	probably benign	0.00
R7026:Abcc2	UTSW	19	43830535	missense	probably benign	0.01
R7136:Abcc2	UTSW	19	43837460	missense	probably damaging	1.00
R7252:Abcc2	UTSW	19	43827949	missense	probably damaging	0.98
R7293:Abcc2	UTSW	19	43807053	missense	probably damaging	1.00
R7392:Abcc2	UTSW	19	43808687	missense	probably damaging	0.97
R7450:Abcc2	UTSW	19	43822039	missense	probably damaging	1.00
R7654:Abcc2	UTSW	19	43826593	missense	possibly damaging	0.87
R7787:Abcc2	UTSW	19	43784246	missense	probably damaging	1.00
R7815:Abcc2	UTSW	19	43830427	missense	probably benign	0.01
R7911:Abcc2	UTSW	19	43803670	missense	probably benign	0.00
R7919:Abcc2	UTSW	19	43816809	missense	probably damaging	1.00
R7925:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
R7993:Abcc2	UTSW	19	43814792	missense	possibly damaging	0.71
R8097:Abcc2	UTSW	19	43816955	missense	probably benign	0.10
R8177:Abcc2	UTSW	19	43807080	missense	probably damaging	1.00
R8492:Abcc2	UTSW	19	43804971	missense	probably benign	0.07
R8693:Abcc2	UTSW	19	43822035	missense	probably benign	0.06
R8722:Abcc2	UTSW	19	43836613	missense	possibly damaging	0.89
R8734:Abcc2	UTSW	19	43782416	missense	probably damaging	1.00
R8774:Abcc2	UTSW	19	43799138	missense	probably damaging	0.99
R8774-TAIL:Abcc2	UTSW	19	43799138	missense	probably damaging	0.99
R8798:Abcc2	UTSW	19	43808666	missense	probably benign	0.01
X0025:Abcc2	UTSW	19	43832205	critical splice donor site	probably null
Z1177:Abcc2	UTSW	19	43803734	missense	probably benign	0.05
Z1177:Abcc2	UTSW	19	43803736	missense	probably benign	0.00
Z1177:Abcc2	UTSW	19	43823100	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTTTGCTGACATAAGCCCTG -3'
(R):5'- TGTCACAGAAAGGGCACATTTC -3'

Sequencing Primer
(F):5'- ACTCGGATGAGGAGATCT -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2014-06-23