Incidental Mutation 'R1812:Rad54b'
ID202450
Institutional Source Beutler Lab
Gene Symbol Rad54b
Ensembl Gene ENSMUSG00000078773
Gene NameRAD54 homolog B (S. cerevisiae)
SynonymsE130016E03Rik, E130016E03Rik
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11558922-11615805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11612770 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 801 (T801S)
Ref Sequence ENSEMBL: ENSMUSP00000066977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070755]
Predicted Effect probably damaging
Transcript: ENSMUST00000070755
AA Change: T801S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: T801S

DomainStartEndE-ValueType
low complexity region 113 121 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
DEXDc 270 470 4.36e-36 SMART
HELICc 652 736 6.14e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148576
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Rad54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Rad54b APN 4 11593765 missense probably benign
IGL00774:Rad54b APN 4 11593765 missense probably benign
IGL00956:Rad54b APN 4 11597833 missense probably damaging 0.98
IGL00961:Rad54b APN 4 11599699 missense probably damaging 1.00
IGL01064:Rad54b APN 4 11604866 missense probably damaging 1.00
IGL02150:Rad54b APN 4 11610502 missense probably damaging 1.00
IGL02326:Rad54b APN 4 11612713 missense probably damaging 1.00
IGL03105:Rad54b APN 4 11615569 missense probably benign 0.00
IGL03143:Rad54b APN 4 11599755 missense probably damaging 1.00
IGL03288:Rad54b APN 4 11569833 missense possibly damaging 0.83
kerplunk UTSW 4 11612655 missense probably damaging 1.00
Schnipfel UTSW 4 11583689 unclassified probably benign
P0033:Rad54b UTSW 4 11609285 unclassified probably benign
R0076:Rad54b UTSW 4 11609480 unclassified probably benign
R0094:Rad54b UTSW 4 11599681 missense possibly damaging 0.92
R0391:Rad54b UTSW 4 11601702 missense probably damaging 0.98
R0441:Rad54b UTSW 4 11563394 missense probably benign 0.08
R0442:Rad54b UTSW 4 11609480 unclassified probably benign
R0442:Rad54b UTSW 4 11610362 missense probably benign 0.02
R0449:Rad54b UTSW 4 11606131 missense probably benign 0.43
R0519:Rad54b UTSW 4 11599809 missense probably damaging 1.00
R0843:Rad54b UTSW 4 11609471 critical splice donor site probably null
R1118:Rad54b UTSW 4 11563352 missense probably damaging 1.00
R1439:Rad54b UTSW 4 11606152 missense possibly damaging 0.90
R1763:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R1854:Rad54b UTSW 4 11601669 missense probably damaging 1.00
R1917:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1918:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1919:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R2057:Rad54b UTSW 4 11606088 missense probably benign 0.08
R2386:Rad54b UTSW 4 11597874 missense probably benign
R2437:Rad54b UTSW 4 11606272 missense probably damaging 1.00
R4299:Rad54b UTSW 4 11597865 missense probably damaging 1.00
R4391:Rad54b UTSW 4 11615570 missense probably benign 0.00
R4672:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4673:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4826:Rad54b UTSW 4 11599753 missense probably damaging 1.00
R4930:Rad54b UTSW 4 11615579 missense probably damaging 0.99
R5796:Rad54b UTSW 4 11615446 missense probably benign 0.01
R5901:Rad54b UTSW 4 11595919 missense possibly damaging 0.84
R6185:Rad54b UTSW 4 11593804 missense possibly damaging 0.51
R6355:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R6576:Rad54b UTSW 4 11601577 missense probably benign
R6684:Rad54b UTSW 4 11583689 unclassified probably benign
R6821:Rad54b UTSW 4 11612777 missense probably damaging 1.00
R6947:Rad54b UTSW 4 11569859 missense possibly damaging 0.83
R7177:Rad54b UTSW 4 11599755 missense probably damaging 1.00
R7361:Rad54b UTSW 4 11599782 missense probably damaging 1.00
R7483:Rad54b UTSW 4 11610372 missense probably damaging 1.00
R7511:Rad54b UTSW 4 11578956 splice site probably null
R7847:Rad54b UTSW 4 11612655 missense probably damaging 1.00
R7908:Rad54b UTSW 4 11595868 missense probably null 0.01
R8198:Rad54b UTSW 4 11612440 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTCAACATCTGAACATCTGG -3'
(R):5'- AGTACTTGCCCTACAACCCGAG -3'

Sequencing Primer
(F):5'- AGAAAATCTAATGGGTGTTTTCTCC -3'
(R):5'- GGAACAAAGAGAACTAACACGTGC -3'
Posted On2014-06-23