Incidental Mutation 'R1812:Or52r1'
ID 202475
Institutional Source Beutler Lab
Gene Symbol Or52r1
Ensembl Gene ENSMUSG00000062142
Gene Name olfactory receptor family 52 subfamily R member 1
Synonyms MOR30-1, GA_x6K02T2PBJ9-5599295-5598351, Olfr569
MMRRC Submission 039840-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R1812 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102536414-102537358 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102537285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 25 (Y25C)
Ref Sequence ENSEMBL: ENSMUSP00000149088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078191] [ENSMUST00000217024]
AlphaFold Q8VGZ2
Predicted Effect probably benign
Transcript: ENSMUST00000078191
AA Change: Y25C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077321
Gene: ENSMUSG00000062142
AA Change: Y25C

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.2e-113 PFAM
Pfam:7TM_GPCR_Srsx 37 229 1.3e-9 PFAM
Pfam:7tm_1 43 294 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217024
AA Change: Y25C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,164,740 (GRCm39) Q545* probably null Het
Aadacl2 T C 3: 59,932,498 (GRCm39) C338R probably damaging Het
Abcb4 G A 5: 8,978,578 (GRCm39) probably null Het
Adam17 T C 12: 21,411,768 (GRCm39) D41G probably damaging Het
Angptl7 T A 4: 148,582,540 (GRCm39) I119F probably damaging Het
Arid1b T A 17: 5,387,304 (GRCm39) S1586T probably benign Het
Arid4b C T 13: 14,370,014 (GRCm39) A1170V probably damaging Het
Atad5 A G 11: 80,023,873 (GRCm39) T1659A probably damaging Het
Bub1b T G 2: 118,462,902 (GRCm39) D754E probably benign Het
Cdkn1a T C 17: 29,317,539 (GRCm39) V53A probably benign Het
Chsy1 T G 7: 65,821,565 (GRCm39) V600G probably benign Het
Cntrl G A 2: 35,039,481 (GRCm39) V561M probably damaging Het
Col6a5 A G 9: 105,805,253 (GRCm39) C1218R unknown Het
Crhr1 T C 11: 104,059,973 (GRCm39) L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,897,020 (GRCm39) probably null Het
Cyp3a59 A T 5: 146,039,621 (GRCm39) Q298L probably damaging Het
Dctn1 A G 6: 83,169,500 (GRCm39) E638G possibly damaging Het
Ddx41 A G 13: 55,683,767 (GRCm39) I88T probably benign Het
Dennd11 A G 6: 40,386,365 (GRCm39) I288T probably benign Het
Diaph1 G T 18: 38,024,071 (GRCm39) P589Q unknown Het
Dip2b C A 15: 100,096,819 (GRCm39) probably null Het
Dscaml1 G A 9: 45,662,584 (GRCm39) probably null Het
Dync1h1 C T 12: 110,629,334 (GRCm39) A4246V possibly damaging Het
Epb41l1 T C 2: 156,338,431 (GRCm39) I158T probably damaging Het
Fat1 A G 8: 45,489,840 (GRCm39) Y3584C probably damaging Het
Fxyd5 T A 7: 30,737,355 (GRCm39) probably null Het
Gapvd1 T A 2: 34,615,076 (GRCm39) K336* probably null Het
Gm9637 G A 14: 19,402,395 (GRCm38) noncoding transcript Het
Gpr65 C T 12: 98,242,001 (GRCm39) T218M probably damaging Het
Gsdma3 T C 11: 98,523,219 (GRCm39) V203A probably damaging Het
Helb T A 10: 119,925,471 (GRCm39) K969* probably null Het
Hipk2 G A 6: 38,675,098 (GRCm39) A1188V probably benign Het
Itpk1 T A 12: 102,540,317 (GRCm39) E255D probably benign Het
Kif21a T C 15: 90,855,969 (GRCm39) D596G possibly damaging Het
Kif5a A T 10: 127,077,879 (GRCm39) I405N probably benign Het
Klk1b11 T A 7: 43,427,179 (GRCm39) probably null Het
Luzp1 T A 4: 136,269,642 (GRCm39) L622M probably benign Het
Macf1 T A 4: 123,325,817 (GRCm39) I5227F probably damaging Het
Mapk10 A C 5: 103,061,128 (GRCm39) S470A probably damaging Het
Morc2a C T 11: 3,635,831 (GRCm39) T897I probably damaging Het
Nmbr A G 10: 14,636,283 (GRCm39) probably null Het
Nosip T A 7: 44,725,998 (GRCm39) M214K probably damaging Het
Or13c7d G T 4: 43,770,230 (GRCm39) Y260* probably null Het
Or52m2 A T 7: 102,263,577 (GRCm39) N206K possibly damaging Het
Or5w13 A G 2: 87,523,447 (GRCm39) F260L probably benign Het
Pik3c2a A T 7: 116,016,899 (GRCm39) V286E probably damaging Het
Ppfia4 T A 1: 134,252,311 (GRCm39) I388F probably benign Het
Ppm1f A G 16: 16,735,651 (GRCm39) H289R probably damaging Het
Ptprz1 T A 6: 22,959,711 (GRCm39) D69E probably benign Het
Rad54b A T 4: 11,612,770 (GRCm39) T801S probably damaging Het
Ramp1 A T 1: 91,124,579 (GRCm39) N47Y probably damaging Het
Rnf32 T A 5: 29,411,258 (GRCm39) H181Q possibly damaging Het
Rpa2 T C 4: 132,495,996 (GRCm39) F6L probably benign Het
Ryr2 C A 13: 11,575,472 (GRCm39) R4842L probably damaging Het
Scn11a G T 9: 119,609,931 (GRCm39) C972* probably null Het
Setd2 C T 9: 110,379,170 (GRCm39) T995I probably damaging Het
Slc39a7 A G 17: 34,247,789 (GRCm39) L471P probably damaging Het
Slc6a21 C G 7: 44,932,371 (GRCm39) S350R probably damaging Het
Slx4ip A G 2: 136,910,115 (GRCm39) N300S probably benign Het
Spef2 G A 15: 9,679,435 (GRCm39) P634L probably damaging Het
Stk32b G A 5: 37,624,102 (GRCm39) A215V probably damaging Het
Svil A T 18: 5,097,545 (GRCm39) Y1676F probably damaging Het
Tanc1 G A 2: 59,622,023 (GRCm39) V381M probably damaging Het
Tanc2 T C 11: 105,777,212 (GRCm39) F797L probably benign Het
Tas2r120 T G 6: 132,634,564 (GRCm39) C215W probably benign Het
Tenm4 G A 7: 96,545,147 (GRCm39) D2388N probably damaging Het
Thsd4 C T 9: 59,964,220 (GRCm39) S64N probably damaging Het
Thsd7b C T 1: 129,686,347 (GRCm39) R630C probably damaging Het
Top3a A G 11: 60,650,188 (GRCm39) I145T probably damaging Het
Vmn2r78 A G 7: 86,569,995 (GRCm39) D171G probably benign Het
Vmn2r82 A G 10: 79,215,046 (GRCm39) E343G probably benign Het
Wdr70 T C 15: 8,108,663 (GRCm39) D161G probably benign Het
Other mutations in Or52r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Or52r1 APN 7 102,536,814 (GRCm39) missense probably damaging 1.00
IGL02505:Or52r1 APN 7 102,536,814 (GRCm39) missense probably damaging 1.00
IGL02885:Or52r1 APN 7 102,537,243 (GRCm39) missense possibly damaging 0.83
IGL03339:Or52r1 APN 7 102,536,989 (GRCm39) missense probably benign 0.02
R0383:Or52r1 UTSW 7 102,536,458 (GRCm39) missense possibly damaging 0.91
R1767:Or52r1 UTSW 7 102,536,833 (GRCm39) missense probably damaging 1.00
R1793:Or52r1 UTSW 7 102,537,250 (GRCm39) missense probably benign 0.44
R6061:Or52r1 UTSW 7 102,537,158 (GRCm39) missense probably benign 0.31
R7855:Or52r1 UTSW 7 102,536,835 (GRCm39) missense probably benign 0.01
R8155:Or52r1 UTSW 7 102,536,452 (GRCm39) missense probably benign 0.00
R8890:Or52r1 UTSW 7 102,536,699 (GRCm39) nonsense probably null
R9131:Or52r1 UTSW 7 102,537,186 (GRCm39) missense probably benign 0.07
R9188:Or52r1 UTSW 7 102,536,596 (GRCm39) missense possibly damaging 0.95
R9398:Or52r1 UTSW 7 102,537,000 (GRCm39) missense probably damaging 1.00
Z1177:Or52r1 UTSW 7 102,536,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGCAGGCGTTGTATTC -3'
(R):5'- AGCAAAATGGCCTGTAGTAACAC -3'

Sequencing Primer
(F):5'- GCAGGCGTTGTATTCAATCTCATGAC -3'
(R):5'- TGGCCTGTAGTAACACAGTTAAC -3'
Posted On 2014-06-23