Mutagenetix > Incidental Mutations

Incidental Mutation 'R1812:Ppm1f'

202512

Institutional Source

Beutler Lab

Gene Symbol

Ppm1f

Ensembl Gene

ENSMUSG00000026181

Gene Name

protein phosphatase 1F (PP2C domain containing)

Synonyms

4933427B07Rik, 1110021B16Rik

MMRRC Submission

039840-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1812 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16896469-16927364 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16917787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 289 (H289R)

Ref Sequence

ENSEMBL: ENSMUSP00000027373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027373] [ENSMUST00000232247]

AlphaFold

Q8CGA0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027373
AA Change: H289R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027373
Gene: ENSMUSG00000026181
AA Change: H289R

Domain	Start	End	E-Value	Type
Blast:PP2Cc	25	97	1e-16	BLAST
low complexity region	99	110	N/A	INTRINSIC
PP2Cc	141	408	3.14e-79	SMART
PP2C_SIG	168	410	5.13e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145978

Predicted Effect

probably benign
Transcript: ENSMUST00000232247

Coding Region Coverage

1x: 97.3%
3x: 96.3%
10x: 93.2%
20x: 85.7%

Validation Efficiency

100% (1/1)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are not detected at weaning. Mice heterozygous for a targeted mutation display hyperactivity and an increase in pain threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	G	A	9: 57,257,457	Q545*	probably null	Het
Aadacl2	T	C	3: 60,025,077	C338R	probably damaging	Het
Abcb4	G	A	5: 8,928,578		probably null	Het
Adam17	T	C	12: 21,361,767	D41G	probably damaging	Het
Angptl7	T	A	4: 148,498,083	I119F	probably damaging	Het
Arid1b	T	A	17: 5,337,029	S1586T	probably benign	Het
Arid4b	C	T	13: 14,195,429	A1170V	probably damaging	Het
Atad5	A	G	11: 80,133,047	T1659A	probably damaging	Het
Bub1b	T	G	2: 118,632,421	D754E	probably benign	Het
Cdkn1a	T	C	17: 29,098,565	V53A	probably benign	Het
Chsy1	T	G	7: 66,171,817	V600G	probably benign	Het
Cntrl	G	A	2: 35,149,469	V561M	probably damaging	Het
Col6a5	A	G	9: 105,928,054	C1218R	unknown	Het
Crhr1	T	C	11: 104,169,147	L140P	probably damaging	Het
Cyb5b	CAGAG	CAG	8: 107,170,388		probably null	Het
Cyp3a59	A	T	5: 146,102,811	Q298L	probably damaging	Het
Dctn1	A	G	6: 83,192,518	E638G	possibly damaging	Het
Ddx41	A	G	13: 55,535,954	I88T	probably benign	Het
Diaph1	G	T	18: 37,891,018	P589Q	unknown	Het
Dip2b	C	A	15: 100,198,938		probably null	Het
Dscaml1	G	A	9: 45,751,286		probably null	Het
Dync1h1	C	T	12: 110,662,900	A4246V	possibly damaging	Het
E330009J07Rik	A	G	6: 40,409,431	I288T	probably benign	Het
Epb41l1	T	C	2: 156,496,511	I158T	probably damaging	Het
Fat1	A	G	8: 45,036,803	Y3584C	probably damaging	Het
Fxyd5	T	A	7: 31,037,930		probably null	Het
Gapvd1	T	A	2: 34,725,064	K336*	probably null	Het
Gm9637	G	A	14: 19,402,395		noncoding transcript	Het
Gpr65	C	T	12: 98,275,742	T218M	probably damaging	Het
Gsdma3	T	C	11: 98,632,393	V203A	probably damaging	Het
Helb	T	A	10: 120,089,566	K969*	probably null	Het
Hipk2	G	A	6: 38,698,163	A1188V	probably benign	Het
Itpk1	T	A	12: 102,574,058	E255D	probably benign	Het
Kif21a	T	C	15: 90,971,766	D596G	possibly damaging	Het
Kif5a	A	T	10: 127,242,010	I405N	probably benign	Het
Klk11	T	A	7: 43,777,755		probably null	Het
Luzp1	T	A	4: 136,542,331	L622M	probably benign	Het
Macf1	T	A	4: 123,432,024	I5227F	probably damaging	Het
Mapk10	A	C	5: 102,913,262	S470A	probably damaging	Het
Morc2a	C	T	11: 3,685,831	T897I	probably damaging	Het
Nmbr	A	G	10: 14,760,539		probably null	Het
Nosip	T	A	7: 45,076,574	M214K	probably damaging	Het
Olfr1136	A	G	2: 87,693,103	F260L	probably benign	Het
Olfr159	G	T	4: 43,770,230	Y260*	probably null	Het
Olfr553	A	T	7: 102,614,370	N206K	possibly damaging	Het
Olfr569	T	C	7: 102,888,078	Y25C	probably benign	Het
Pik3c2a	A	T	7: 116,417,664	V286E	probably damaging	Het
Ppfia4	T	A	1: 134,324,573	I388F	probably benign	Het
Ptprz1	T	A	6: 22,959,712	D69E	probably benign	Het
Rad54b	A	T	4: 11,612,770	T801S	probably damaging	Het
Ramp1	A	T	1: 91,196,857	N47Y	probably damaging	Het
Rnf32	T	A	5: 29,206,260	H181Q	possibly damaging	Het
Rpa2	T	C	4: 132,768,685	F6L	probably benign	Het
Ryr2	C	A	13: 11,560,586	R4842L	probably damaging	Het
Scn11a	G	T	9: 119,780,865	C972*	probably null	Het
Setd2	C	T	9: 110,550,102	T995I	probably damaging	Het
Slc39a7	A	G	17: 34,028,815	L471P	probably damaging	Het
Slc6a21	C	G	7: 45,282,947	S350R	probably damaging	Het
Slx4ip	A	G	2: 137,068,195	N300S	probably benign	Het
Spef2	G	A	15: 9,679,349	P634L	probably damaging	Het
Stk32b	G	A	5: 37,466,758	A215V	probably damaging	Het
Svil	A	T	18: 5,097,545	Y1676F	probably damaging	Het
Tanc1	G	A	2: 59,791,679	V381M	probably damaging	Het
Tanc2	T	C	11: 105,886,386	F797L	probably benign	Het
Tas2r120	T	G	6: 132,657,601	C215W	probably benign	Het
Tenm4	G	A	7: 96,895,940	D2388N	probably damaging	Het
Thsd4	C	T	9: 60,056,937	S64N	probably damaging	Het
Thsd7b	C	T	1: 129,758,610	R630C	probably damaging	Het
Top3a	A	G	11: 60,759,362	I145T	probably damaging	Het
Vmn2r78	A	G	7: 86,920,787	D171G	probably benign	Het
Vmn2r82	A	G	10: 79,379,212	E343G	probably benign	Het
Wdr70	T	C	15: 8,079,179	D161G	probably benign	Het

Other mutations in Ppm1f

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Ppm1f	APN	16	16923913	missense	probably benign	0.03
IGL00495:Ppm1f	APN	16	16910971	missense	possibly damaging	0.87
IGL01024:Ppm1f	APN	16	16923769	missense	probably benign	0.05
IGL02076:Ppm1f	APN	16	16914171	missense	possibly damaging	0.93
IGL02332:Ppm1f	APN	16	16914087	missense	possibly damaging	0.72
IGL02422:Ppm1f	APN	16	16917716	missense	probably damaging	0.99
IGL02936:Ppm1f	APN	16	16915236	missense	probably damaging	1.00
IGL03118:Ppm1f	APN	16	16914078	missense	probably null	0.03
R0348:Ppm1f	UTSW	16	16903390	start codon destroyed	probably null	0.71
R0621:Ppm1f	UTSW	16	16915308	missense	probably benign	0.00
R0970:Ppm1f	UTSW	16	16903593	critical splice donor site	probably null
R1785:Ppm1f	UTSW	16	16910970	missense	probably benign
R1988:Ppm1f	UTSW	16	16923666	missense	probably damaging	0.98
R2080:Ppm1f	UTSW	16	16923880	missense	possibly damaging	0.50
R3687:Ppm1f	UTSW	16	16923883	missense	probably damaging	0.96
R5456:Ppm1f	UTSW	16	16923746	missense	probably damaging	0.99
R7162:Ppm1f	UTSW	16	16914193	missense	probably damaging	1.00
R7290:Ppm1f	UTSW	16	16910955	missense	probably benign
R7391:Ppm1f	UTSW	16	16914234	missense	probably benign	0.04
R8492:Ppm1f	UTSW	16	16915178	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATAAGTAGGGCTGTGGGTTCC -3'
(R):5'- TCTGGGCTCTCACTGTGATC -3'

Sequencing Primer
(F):5'- GTGTAGGCTCGTTTTCCTCCTCAG -3'
(R):5'- AGAACTCTCTGGAGGGCTCATG -3'

Posted On

2014-06-23