Incidental Mutation 'R1813:Adam23'
ID202521
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1813 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63545572 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 380 (A380T)
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably benign
Transcript: ENSMUST00000087374
AA Change: A380T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: A380T

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097717
SMART Domains Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 2 63 6.3e-16 PFAM
Pfam:Reprolysin_5 111 286 2.7e-7 PFAM
Pfam:Reprolysin 112 309 5.7e-57 PFAM
Pfam:Reprolysin_3 136 240 8.7e-7 PFAM
DISIN 324 399 1.4e-30 SMART
ACR 400 541 3.6e-63 SMART
EGF 548 582 9e-2 SMART
transmembrane domain 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114101
SMART Domains Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 87 247 1.3e-30 PFAM
Pfam:Reprolysin_5 295 470 3.3e-9 PFAM
Pfam:Reprolysin 296 493 8.1e-59 PFAM
Pfam:Reprolysin_3 320 426 1.1e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 686 4.34e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114103
AA Change: A380T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: A380T

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114107
AA Change: A380T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: A380T

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190658
Meta Mutation Damage Score 0.2564 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB007:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 splice site probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8261:Adam23 UTSW 1 63528798 missense noncoding transcript
R8425:Adam23 UTSW 1 63585377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATGTTTGACCCAGTG -3'
(R):5'- AGTAGAGCTGAAGGCCACTG -3'

Sequencing Primer
(F):5'- ATGTTTGACCCAGTGTTTGCC -3'
(R):5'- GCTGAAGGCCACTGAACCAAG -3'
Posted On2014-06-23