Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:Zfp335'

202530

Institutional Source

Beutler Lab

Gene Symbol

Zfp335

Ensembl Gene

ENSMUSG00000039834

Gene Name

zinc finger protein 335

Synonyms

1810045J01Rik

MMRRC Submission

039841-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

164891882-164911757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 164892605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1247 (V1247A)

Ref Sequence

ENSEMBL: ENSMUSP00000038298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]

AlphaFold

A2A5K6

Predicted Effect

probably damaging
Transcript: ENSMUST00000041361
AA Change: V1247A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: V1247A

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART
ZnF_C2H2	591	613	2.53e-2	SMART
ZnF_C2H2	622	644	6.78e-3	SMART
ZnF_C2H2	650	673	8.22e-2	SMART
ZnF_C2H2	679	702	3.29e-1	SMART
low complexity region	711	726	N/A	INTRINSIC
internal_repeat_3	770	937	7.16e-5	PROSPERO
low complexity region	1005	1015	N/A	INTRINSIC
ZnF_C2H2	1019	1041	2.95e-3	SMART
ZnF_C2H2	1047	1069	5.5e-3	SMART
ZnF_C2H2	1075	1097	1.58e-3	SMART
ZnF_C2H2	1103	1126	3.34e-2	SMART
low complexity region	1288	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000041643

SMART Domains

Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

Domain	Start	End	E-Value	Type
WW	44	77	4.34e-4	SMART
low complexity region	132	148	N/A	INTRINSIC
Pfam:PCIF1_WW	445	620	7.1e-74	PFAM
low complexity region	675	686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183830

SMART Domains

Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART

Meta Mutation Damage Score

0.2562

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,566,273	N595Y	probably benign	Het
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cntnap2	T	C	6: 46,530,633	Y61C	probably damaging	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
E2f3	T	C	13: 29,920,176	D140G	probably damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plekhm2	C	T	4: 141,642,439	V82M	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc4a4	A	G	5: 89,046,308	T172A	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Usp25	A	G	16: 77,114,950	I956V	probably benign	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wasf1	T	A	10: 40,926,589	V80D	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in Zfp335

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Zfp335	APN	2	164892382	missense	probably damaging	1.00
IGL00921:Zfp335	APN	2	164894776	missense	possibly damaging	0.51
IGL00980:Zfp335	APN	2	164902674	nonsense	probably null
IGL01145:Zfp335	APN	2	164907502	missense	probably benign	0.03
IGL01568:Zfp335	APN	2	164894788	missense	possibly damaging	0.70
IGL01612:Zfp335	APN	2	164910620	critical splice donor site	probably null
IGL02138:Zfp335	APN	2	164893804	missense	probably damaging	1.00
IGL02675:Zfp335	APN	2	164910689	missense	probably benign
IGL03206:Zfp335	APN	2	164892681	splice site	probably benign
IGL03269:Zfp335	APN	2	164900354	missense	probably damaging	1.00
IGL03306:Zfp335	APN	2	164895984	splice site	probably benign
FR4342:Zfp335	UTSW	2	164907465	small insertion	probably benign
FR4342:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907483	small insertion	probably benign
FR4548:Zfp335	UTSW	2	164907472	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907475	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907484	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907478	small insertion	probably benign
PIT4403001:Zfp335	UTSW	2	164893716	missense	possibly damaging	0.56
R0005:Zfp335	UTSW	2	164909302	missense	possibly damaging	0.91
R0101:Zfp335	UTSW	2	164899990	missense	probably damaging	1.00
R0196:Zfp335	UTSW	2	164896145	missense	possibly damaging	0.88
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0533:Zfp335	UTSW	2	164907922	nonsense	probably null
R0865:Zfp335	UTSW	2	164899495	splice site	probably null
R1023:Zfp335	UTSW	2	164892585	missense	possibly damaging	0.88
R1029:Zfp335	UTSW	2	164892678	splice site	probably benign
R1052:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1106:Zfp335	UTSW	2	164907551	small deletion	probably benign
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1274:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1386:Zfp335	UTSW	2	164898241	missense	probably benign	0.00
R1433:Zfp335	UTSW	2	164899456	missense	probably damaging	0.99
R1959:Zfp335	UTSW	2	164894802	missense	probably damaging	1.00
R2372:Zfp335	UTSW	2	164895039	missense	probably damaging	1.00
R3847:Zfp335	UTSW	2	164900106	splice site	probably null
R3937:Zfp335	UTSW	2	164910700	missense	probably damaging	1.00
R3946:Zfp335	UTSW	2	164892189	missense	probably damaging	1.00
R3979:Zfp335	UTSW	2	164910638	missense	probably benign	0.00
R4019:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4020:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4668:Zfp335	UTSW	2	164900286	missense	probably damaging	1.00
R5000:Zfp335	UTSW	2	164894668	missense	probably benign
R5038:Zfp335	UTSW	2	164910644	nonsense	probably null
R5245:Zfp335	UTSW	2	164894758	missense	probably benign
R5411:Zfp335	UTSW	2	164902245	missense	probably damaging	0.99
R5422:Zfp335	UTSW	2	164907730	missense	probably damaging	1.00
R5968:Zfp335	UTSW	2	164892394	missense	probably damaging	0.99
R6056:Zfp335	UTSW	2	164895098	splice site	probably null
R6551:Zfp335	UTSW	2	164909365	missense	probably benign
R6927:Zfp335	UTSW	2	164893720	missense	probably damaging	1.00
R6943:Zfp335	UTSW	2	164894875	missense	possibly damaging	0.50
R6995:Zfp335	UTSW	2	164893290	nonsense	probably null
R7174:Zfp335	UTSW	2	164902503	missense	probably damaging	1.00
R7185:Zfp335	UTSW	2	164893244	critical splice donor site	probably null
R7296:Zfp335	UTSW	2	164900132	missense	probably damaging	0.99
R7322:Zfp335	UTSW	2	164910821	start codon destroyed	probably null	0.90
R7504:Zfp335	UTSW	2	164909418	missense	probably benign	0.27
R7560:Zfp335	UTSW	2	164895992	missense	probably damaging	1.00
R7637:Zfp335	UTSW	2	164892539	critical splice donor site	probably null
R8064:Zfp335	UTSW	2	164907700	missense	probably damaging	1.00
R8208:Zfp335	UTSW	2	164893616	critical splice acceptor site	probably null
R8228:Zfp335	UTSW	2	164904898	missense	probably damaging	1.00
R8271:Zfp335	UTSW	2	164898053	missense	probably damaging	0.98
R8688:Zfp335	UTSW	2	164892193	missense	probably damaging	1.00
R8803:Zfp335	UTSW	2	164909370	missense	probably benign	0.14
R9266:Zfp335	UTSW	2	164896087	missense	probably benign	0.33
R9352:Zfp335	UTSW	2	164900322	missense	probably damaging	0.99
R9487:Zfp335	UTSW	2	164893475	missense	probably damaging	0.99
R9752:Zfp335	UTSW	2	164907427	critical splice donor site	probably null
RF031:Zfp335	UTSW	2	164907463	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATACCTGTGACAGCGGAGTG -3'
(R):5'- GAGGCCATTGTCCATAGCTGTG -3'

Sequencing Primer
(F):5'- TGAGCCTGGGTGACAAGC -3'
(R):5'- TACCCAGCTCCCACTGAGTG -3'

Posted On

2014-06-23