Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:Plekhm2'

202534

Institutional Source

Beutler Lab

Gene Symbol

Plekhm2

Ensembl Gene

ENSMUSG00000028917

Gene Name

pleckstrin homology domain containing, family M (with RUN domain) member 2

Synonyms

2310034J19Rik

MMRRC Submission

039841-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1813 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

141625734-141664899 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 141642439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 82 (V82M)

Ref Sequence

ENSEMBL: ENSMUSP00000030751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030751
AA Change: V82M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: V82M

Domain	Start	End	E-Value	Type
RUN	93	156	3.18e-21	SMART
low complexity region	230	246	N/A	INTRINSIC
low complexity region	295	307	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
low complexity region	485	495	N/A	INTRINSIC
low complexity region	505	538	N/A	INTRINSIC
Blast:PH	596	656	7e-31	BLAST
PH	766	869	2.43e-12	SMART
Blast:PH	879	960	6e-9	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084203
AA Change: V82M

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: V82M

Domain	Start	End	E-Value	Type
RUN	93	156	3.18e-21	SMART
low complexity region	250	266	N/A	INTRINSIC
low complexity region	315	327	N/A	INTRINSIC
low complexity region	479	489	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
low complexity region	525	558	N/A	INTRINSIC
Blast:PH	616	676	7e-31	BLAST
PH	786	889	2.43e-12	SMART
Blast:PH	899	980	6e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141844

Meta Mutation Damage Score

0.0858

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,566,273	N595Y	probably benign	Het
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cntnap2	T	C	6: 46,530,633	Y61C	probably damaging	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
E2f3	T	C	13: 29,920,176	D140G	probably damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc4a4	A	G	5: 89,046,308	T172A	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Usp25	A	G	16: 77,114,950	I956V	probably benign	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wasf1	T	A	10: 40,926,589	V80D	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp335	A	G	2: 164,892,605	V1247A	probably damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in Plekhm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Plekhm2	APN	4	141642645	splice site	probably null
IGL01388:Plekhm2	APN	4	141642001	missense	probably damaging	1.00
IGL01392:Plekhm2	APN	4	141642426	missense	probably damaging	0.98
IGL01482:Plekhm2	APN	4	141630029	missense	probably damaging	0.98
IGL01828:Plekhm2	APN	4	141629585	missense	probably benign	0.11
IGL02010:Plekhm2	APN	4	141637419	splice site	probably benign
IGL02075:Plekhm2	APN	4	141628306	missense	probably benign	0.38
IGL02381:Plekhm2	APN	4	141642723	missense	possibly damaging	0.95
IGL02543:Plekhm2	APN	4	141642019	missense	probably benign	0.02
IGL02747:Plekhm2	APN	4	141634272	missense	possibly damaging	0.55
IGL02802:Plekhm2	APN	4	141642524	splice site	probably benign
IGL02828:Plekhm2	APN	4	141629630	missense	probably damaging	1.00
IGL03286:Plekhm2	APN	4	141634347	missense	possibly damaging	0.95
R0008:Plekhm2	UTSW	4	141642393	splice site	probably benign
R0008:Plekhm2	UTSW	4	141642393	splice site	probably benign
R0639:Plekhm2	UTSW	4	141642070	missense	probably damaging	1.00
R0682:Plekhm2	UTSW	4	141628125	missense	probably damaging	0.97
R0968:Plekhm2	UTSW	4	141629932	missense	probably benign	0.01
R1109:Plekhm2	UTSW	4	141627984	missense	probably benign	0.31
R1475:Plekhm2	UTSW	4	141627854	missense	possibly damaging	0.75
R1802:Plekhm2	UTSW	4	141634347	missense	probably benign	0.03
R1844:Plekhm2	UTSW	4	141632374	missense	probably benign
R2261:Plekhm2	UTSW	4	141642732	missense	probably damaging	0.98
R3889:Plekhm2	UTSW	4	141641990	splice site	probably benign
R3922:Plekhm2	UTSW	4	141629532	missense	probably benign	0.01
R4324:Plekhm2	UTSW	4	141631857	missense	possibly damaging	0.86
R4758:Plekhm2	UTSW	4	141642005	missense	possibly damaging	0.91
R4814:Plekhm2	UTSW	4	141627839	missense	probably benign	0.00
R4983:Plekhm2	UTSW	4	141634376	missense	probably damaging	1.00
R5468:Plekhm2	UTSW	4	141628100	missense	probably damaging	1.00
R5691:Plekhm2	UTSW	4	141628289	missense	possibly damaging	0.96
R5877:Plekhm2	UTSW	4	141639693	missense	probably damaging	0.98
R6268:Plekhm2	UTSW	4	141632341	nonsense	probably null
R6367:Plekhm2	UTSW	4	141639705	missense	probably damaging	0.97
R6371:Plekhm2	UTSW	4	141629532	missense	possibly damaging	0.94
R6489:Plekhm2	UTSW	4	141632033	missense	probably damaging	1.00
R7266:Plekhm2	UTSW	4	141642459	missense	possibly damaging	0.91
R7399:Plekhm2	UTSW	4	141634376	missense	probably damaging	1.00
R7573:Plekhm2	UTSW	4	141631347	missense	probably benign	0.02
R7742:Plekhm2	UTSW	4	141627839	missense	probably benign	0.00
R7864:Plekhm2	UTSW	4	141628046	missense	probably damaging	0.96
R7920:Plekhm2	UTSW	4	141632121	missense	probably damaging	1.00
R8417:Plekhm2	UTSW	4	141627825	missense	probably benign	0.04
R8462:Plekhm2	UTSW	4	141639819	missense	probably damaging	1.00
R8504:Plekhm2	UTSW	4	141642453	missense	probably damaging	1.00
R8851:Plekhm2	UTSW	4	141631328	missense	probably benign	0.04
R8855:Plekhm2	UTSW	4	141634347	missense	probably benign	0.03
R9051:Plekhm2	UTSW	4	141632421	missense	possibly damaging	0.50
R9080:Plekhm2	UTSW	4	141631728	missense	probably damaging	1.00
R9252:Plekhm2	UTSW	4	141629132	missense	probably damaging	1.00
R9298:Plekhm2	UTSW	4	141629518	missense	probably benign
R9383:Plekhm2	UTSW	4	141632301	missense	probably damaging	1.00
R9463:Plekhm2	UTSW	4	141630638	missense	probably benign	0.10
T0722:Plekhm2	UTSW	4	141631981	small deletion	probably benign
T0975:Plekhm2	UTSW	4	141631981	small deletion	probably benign
X0024:Plekhm2	UTSW	4	141628041	missense	probably damaging	1.00
Z1177:Plekhm2	UTSW	4	141629085	missense	possibly damaging	0.77
Z1177:Plekhm2	UTSW	4	141639822	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AACTGTCACATGCAGGGGAG -3'
(R):5'- TGTACGGGTGAGTTCAGTCC -3'

Sequencing Primer
(F):5'- CAAGACAGACAGACAGCTG -3'
(R):5'- GGTGAGTTCAGTCCCCTCC -3'

Posted On

2014-06-23