Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:Slc4a4'

202536

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

039841-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89046308 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 172 (T172A)

Ref Sequence

ENSEMBL: ENSMUSP00000119976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113216] [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000134303] [ENSMUST00000148750] [ENSMUST00000156238]

AlphaFold

O88343

Predicted Effect

probably benign
Transcript: ENSMUST00000113216

SMART Domains

Protein: ENSMUSP00000108842
Gene: ENSMUSG00000060961

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	149	4.2e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113218
AA Change: T216A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: T216A

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130041
AA Change: T172A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: T172A

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000134303
AA Change: T172A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119976
Gene: ENSMUSG00000060961
AA Change: T172A

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	233	1.4e-36	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148750
AA Change: T216A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: T216A

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156238
AA Change: T216A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: T216A

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.1116

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,566,273	N595Y	probably benign	Het
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cntnap2	T	C	6: 46,530,633	Y61C	probably damaging	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
E2f3	T	C	13: 29,920,176	D140G	probably damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plekhm2	C	T	4: 141,642,439	V82M	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Usp25	A	G	16: 77,114,950	I956V	probably benign	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wasf1	T	A	10: 40,926,589	V80D	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp335	A	G	2: 164,892,605	V1247A	probably damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
Therapod	UTSW	5	89135722	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78
R7931:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
R8534:Slc4a4	UTSW	5	89135722	missense	probably damaging	1.00
R8735:Slc4a4	UTSW	5	89132442	missense	probably damaging	1.00
R8786:Slc4a4	UTSW	5	89084690	missense	probably benign	0.07
R8968:Slc4a4	UTSW	5	89084653	missense	probably benign
R9014:Slc4a4	UTSW	5	89132386	missense	probably damaging	1.00
R9031:Slc4a4	UTSW	5	89057709	intron	probably benign
R9195:Slc4a4	UTSW	5	89133196	missense	possibly damaging	0.82
R9236:Slc4a4	UTSW	5	89046299	nonsense	probably null
R9261:Slc4a4	UTSW	5	89199709	missense	probably damaging	1.00
R9325:Slc4a4	UTSW	5	89228897	missense	probably damaging	1.00
R9401:Slc4a4	UTSW	5	89179666	missense	probably damaging	1.00
R9457:Slc4a4	UTSW	5	89214573	missense	probably damaging	1.00
R9462:Slc4a4	UTSW	5	89046272	missense	probably damaging	1.00
R9681:Slc4a4	UTSW	5	88954864	nonsense	probably null
R9709:Slc4a4	UTSW	5	89040346	splice site	probably null
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATCCACAAGGCTGGAGTG -3'
(R):5'- ACACCCAGTTATACTACGAGGATC -3'

Sequencing Primer
(F):5'- CACAAGGCTGGAGTGACAGTTC -3'
(R):5'- TCATGAAATGACCATGGCGC -3'

Posted On

2014-06-23