Incidental Mutation 'R1813:Uso1'
ID 202537
Institutional Source Beutler Lab
Gene Symbol Uso1
Ensembl Gene ENSMUSG00000029407
Gene Name USO1 vesicle docking factor
Synonyms transcytosis associated protein p115, TAP, Vdp
MMRRC Submission 039841-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92285797-92350657 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 92348992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]
AlphaFold Q9Z1Z0
Predicted Effect probably null
Transcript: ENSMUST00000031355
SMART Domains Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 6.5e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
Pfam:Uso1_p115_C 782 954 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201642
SMART Domains Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
PDB:3GRL|A 1 52 5e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000202155
SMART Domains Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 5.7e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Pfam:Uso1_p115_C 730 892 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202362
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,543,236 (GRCm39) N595Y probably benign Het
Abca6 A G 11: 110,124,671 (GRCm39) probably benign Het
Abo C A 2: 26,733,609 (GRCm39) D199Y probably damaging Het
Acvr1c A C 2: 58,170,306 (GRCm39) V277G probably damaging Het
Adam23 G A 1: 63,584,731 (GRCm39) A380T probably benign Het
Art2b A G 7: 101,229,236 (GRCm39) V221A probably benign Het
Bcam A G 7: 19,500,640 (GRCm39) S153P probably damaging Het
Brip1 T C 11: 86,077,906 (GRCm39) H174R possibly damaging Het
Ccdc186 T C 19: 56,788,601 (GRCm39) D536G probably benign Het
Cd109 A G 9: 78,524,287 (GRCm39) N67S probably benign Het
Cd8a G T 6: 71,350,947 (GRCm39) M137I possibly damaging Het
Ces2g T C 8: 105,693,569 (GRCm39) F417L probably benign Het
Clec2g A G 6: 128,925,660 (GRCm39) N23S unknown Het
Cntnap2 T C 6: 46,507,567 (GRCm39) Y61C probably damaging Het
Cog3 T A 14: 75,979,784 (GRCm39) E182D probably benign Het
Dbpht2 A G 12: 74,342,624 (GRCm39) noncoding transcript Het
Dock4 A T 12: 40,686,227 (GRCm39) N154I probably damaging Het
Dysf T G 6: 84,128,906 (GRCm39) V1422G possibly damaging Het
E2f3 T C 13: 30,104,159 (GRCm39) D140G probably damaging Het
Efcab3 A G 11: 104,611,514 (GRCm39) K452R probably benign Het
Epb41l2 T A 10: 25,317,466 (GRCm39) probably null Het
Epha2 A G 4: 141,035,857 (GRCm39) K98E possibly damaging Het
Esyt1 T C 10: 128,355,487 (GRCm39) D444G probably benign Het
Fam163a T C 1: 155,955,787 (GRCm39) T2A probably damaging Het
Foxp2 A T 6: 15,379,767 (GRCm39) probably benign Het
Gcm2 T C 13: 41,259,367 (GRCm39) H34R probably benign Het
Gipr A G 7: 18,897,996 (GRCm39) S79P probably benign Het
Gli3 T C 13: 15,823,276 (GRCm39) S333P probably damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gzmk A G 13: 113,309,427 (GRCm39) S208P probably damaging Het
Htra2 G T 6: 83,028,583 (GRCm39) A318D probably damaging Het
Itpkc T C 7: 26,907,805 (GRCm39) D633G probably damaging Het
Lama1 G A 17: 68,098,218 (GRCm39) R1805H probably benign Het
Lama4 T A 10: 38,909,121 (GRCm39) probably benign Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Notch3 T C 17: 32,362,402 (GRCm39) T1408A probably benign Het
Nwd2 A G 5: 63,962,753 (GRCm39) D779G probably benign Het
Nxpe4 A G 9: 48,304,678 (GRCm39) Y255C possibly damaging Het
Obox6 A T 7: 15,568,770 (GRCm39) H35Q possibly damaging Het
Or2ab1 A G 11: 58,489,133 (GRCm39) I304V probably damaging Het
Or8b41 T A 9: 38,055,025 (GRCm39) I198N possibly damaging Het
Pkig T A 2: 163,563,147 (GRCm39) I26N possibly damaging Het
Plekhm2 C T 4: 141,369,750 (GRCm39) V82M possibly damaging Het
Plppr2 G A 9: 21,859,220 (GRCm39) A446T probably damaging Het
Psme4 T A 11: 30,754,353 (GRCm39) F203L probably benign Het
Sh3bp1 A G 15: 78,787,880 (GRCm39) K137E probably damaging Het
Shisa5 T A 9: 108,885,108 (GRCm39) I126N probably damaging Het
Slc11a1 T C 1: 74,414,931 (GRCm39) L21P probably benign Het
Slc35f1 C T 10: 52,809,291 (GRCm39) P93S probably damaging Het
Slc4a4 A G 5: 89,194,167 (GRCm39) T172A probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Spata31 T C 13: 65,069,612 (GRCm39) S587P probably benign Het
Syna C A 5: 134,588,006 (GRCm39) M314I probably benign Het
Taf5l A G 8: 124,730,152 (GRCm39) L144P probably damaging Het
Tbccd1 T C 16: 22,641,271 (GRCm39) T369A probably benign Het
Tnfrsf11b A T 15: 54,119,493 (GRCm39) C160* probably null Het
Trim45 A G 3: 100,830,283 (GRCm39) N19S probably benign Het
Uba2 A G 7: 33,850,455 (GRCm39) F364S probably damaging Het
Unc50 T A 1: 37,476,323 (GRCm39) L161Q probably damaging Het
Usp25 A G 16: 76,911,838 (GRCm39) I956V probably benign Het
Utf1 C A 7: 139,524,213 (GRCm39) L143I probably damaging Het
Vmn1r158 C T 7: 22,490,143 (GRCm39) C22Y probably damaging Het
Vmn1r36 T A 6: 66,693,756 (GRCm39) M40L probably benign Het
Vmn2r43 A G 7: 8,258,055 (GRCm39) V386A possibly damaging Het
Vps9d1 C A 8: 123,973,778 (GRCm39) R335L probably damaging Het
Wasf1 T A 10: 40,802,585 (GRCm39) V80D probably damaging Het
Wdr72 G A 9: 74,183,298 (GRCm39) V1077I possibly damaging Het
Wnt8a A G 18: 34,675,422 (GRCm39) M1V probably null Het
Zbtb26 A G 2: 37,326,347 (GRCm39) S230P possibly damaging Het
Zfp335 A G 2: 164,734,525 (GRCm39) V1247A probably damaging Het
Zfp429 T C 13: 67,538,505 (GRCm39) N313S possibly damaging Het
Zfp74 A T 7: 29,634,569 (GRCm39) C380S probably damaging Het
Zfyve21 G A 12: 111,791,328 (GRCm39) E134K probably damaging Het
Zmynd11 T C 13: 9,739,616 (GRCm39) T474A possibly damaging Het
Other mutations in Uso1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Uso1 APN 5 92,329,278 (GRCm39) missense probably damaging 0.96
IGL01753:Uso1 APN 5 92,300,777 (GRCm39) critical splice donor site probably null
IGL02311:Uso1 APN 5 92,335,635 (GRCm39) missense probably benign
IGL02539:Uso1 APN 5 92,335,632 (GRCm39) missense probably damaging 1.00
IGL02716:Uso1 APN 5 92,321,794 (GRCm39) missense probably damaging 0.99
IGL03154:Uso1 APN 5 92,328,477 (GRCm39) nonsense probably null
R0558:Uso1 UTSW 5 92,321,878 (GRCm39) missense probably benign 0.03
R0570:Uso1 UTSW 5 92,347,682 (GRCm39) missense probably benign 0.19
R1195:Uso1 UTSW 5 92,318,606 (GRCm39) missense probably damaging 1.00
R1195:Uso1 UTSW 5 92,318,606 (GRCm39) missense probably damaging 1.00
R1195:Uso1 UTSW 5 92,318,606 (GRCm39) missense probably damaging 1.00
R1398:Uso1 UTSW 5 92,329,327 (GRCm39) missense probably benign 0.16
R1485:Uso1 UTSW 5 92,328,422 (GRCm39) missense possibly damaging 0.76
R1873:Uso1 UTSW 5 92,340,718 (GRCm39) splice site probably benign
R1896:Uso1 UTSW 5 92,348,992 (GRCm39) critical splice acceptor site probably null
R1899:Uso1 UTSW 5 92,349,051 (GRCm39) missense probably benign 0.27
R2049:Uso1 UTSW 5 92,329,795 (GRCm39) missense probably damaging 1.00
R2128:Uso1 UTSW 5 92,343,229 (GRCm39) missense probably benign
R2411:Uso1 UTSW 5 92,306,258 (GRCm39) splice site probably benign
R2903:Uso1 UTSW 5 92,343,294 (GRCm39) critical splice donor site probably null
R5055:Uso1 UTSW 5 92,340,594 (GRCm39) missense probably benign 0.31
R5155:Uso1 UTSW 5 92,315,194 (GRCm39) critical splice donor site probably null
R5590:Uso1 UTSW 5 92,328,467 (GRCm39) missense probably benign 0.05
R5665:Uso1 UTSW 5 92,346,196 (GRCm39) missense possibly damaging 0.95
R5677:Uso1 UTSW 5 92,349,158 (GRCm39) missense probably damaging 1.00
R5996:Uso1 UTSW 5 92,340,589 (GRCm39) missense probably benign 0.00
R6165:Uso1 UTSW 5 92,335,126 (GRCm39) missense probably damaging 1.00
R6340:Uso1 UTSW 5 92,347,711 (GRCm39) missense probably benign 0.01
R6701:Uso1 UTSW 5 92,314,444 (GRCm39) missense probably damaging 1.00
R6860:Uso1 UTSW 5 92,343,207 (GRCm39) missense probably benign 0.11
R7062:Uso1 UTSW 5 92,340,599 (GRCm39) missense possibly damaging 0.62
R7133:Uso1 UTSW 5 92,306,324 (GRCm39) missense probably benign 0.12
R7317:Uso1 UTSW 5 92,321,851 (GRCm39) missense possibly damaging 0.70
R7527:Uso1 UTSW 5 92,347,734 (GRCm39) missense possibly damaging 0.58
R7648:Uso1 UTSW 5 92,341,861 (GRCm39) splice site probably null
R7707:Uso1 UTSW 5 92,349,795 (GRCm39) makesense probably null
R8009:Uso1 UTSW 5 92,314,439 (GRCm39) missense probably benign 0.03
R8104:Uso1 UTSW 5 92,306,280 (GRCm39) missense probably damaging 0.99
R8361:Uso1 UTSW 5 92,337,121 (GRCm39) missense probably null 0.00
R8519:Uso1 UTSW 5 92,343,222 (GRCm39) missense probably benign
R9052:Uso1 UTSW 5 92,328,422 (GRCm39) missense probably damaging 1.00
R9142:Uso1 UTSW 5 92,335,125 (GRCm39) nonsense probably null
R9221:Uso1 UTSW 5 92,335,173 (GRCm39) missense probably benign 0.38
R9492:Uso1 UTSW 5 92,315,191 (GRCm39) missense possibly damaging 0.77
R9642:Uso1 UTSW 5 92,285,967 (GRCm39) missense probably damaging 1.00
Z1177:Uso1 UTSW 5 92,285,989 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGTGGTGTCTGTCAGAAGC -3'
(R):5'- TTCTGATCTTGATCTGCTAACAGC -3'

Sequencing Primer
(F):5'- GTCTGTCAGAAGCAGTTTACAGC -3'
(R):5'- GCACCAAAAGGTCATCTTGTTC -3'
Posted On 2014-06-23